Search engine for discovering works of Art, research articles, and books related to Art and Culture
ShareThis
Javascript must be enabled to continue!

Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria

View through CrossRef
There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.
Title: Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria
Description:
There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility.
The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria.
At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA).
Semen was collected from the participants under the WHO guideline for semen collection and processing.
Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer.
Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA.
PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers.
Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa.
Agarose gel electrophoresis was used to show the amplified PRM2.
In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered.
The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different.
We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.

Related Results

Generation of reactive oxygen species by equine spermatozoa
Generation of reactive oxygen species by equine spermatozoa
Abstract Objective—To characterize generation of reactive oxygen species (ROS) by equine spermatozoa. Sample Population—Multiple semen samples collected from 9 ...
Heparin-protamine management: a comparison study of three different heparin-protamine management protocols
Heparin-protamine management: a comparison study of three different heparin-protamine management protocols
In a prospective randomized open study, 180 patients underwent open-heart surgery using cardiopulmonary bypass (CPB) and were divided into three different heparin-protamine managem...
P-065 Phenotype, genetic analysis and treatment strategy of acephalic spermatozoa
P-065 Phenotype, genetic analysis and treatment strategy of acephalic spermatozoa
Abstract Study question Do severe acephalic spermatozoa syndrome (ASS) patients with different genes variants obtain good fertil...
Karakteristik Spermatozoa Domba yang Diinkubasi Dalam Medium Fertilisasi dengan Waktu dan Konsentrasi Berbeda
Karakteristik Spermatozoa Domba yang Diinkubasi Dalam Medium Fertilisasi dengan Waktu dan Konsentrasi Berbeda
Keberhasilan fertilisasi in vitro tidak hanya dipengaruhi oleh oosit tetapi juga kualitas spermatozoa, konsentrasi spermatozoa, dan lamanya waktu inkubasi. Penelitian ini bertujuan...
Fructolysis in Human Spermatozoa Under Normal and Pathological Conditions
Fructolysis in Human Spermatozoa Under Normal and Pathological Conditions
Anaerobic fructolysis was studied in human spermatozoa from 1) normal, 2) oligospermic, and 3) necrospermic semen, as well as 4) in normal spermatozoa irreversibly immobilized with...
Detection of protamine 2 in bovine spermatozoa and testicles
Detection of protamine 2 in bovine spermatozoa and testicles
AbstractBackgroundSperm DNA integrity is crucial for transmission of genetic information to future generations and DNA damage can occur during chromatin packaging. Chromatin packag...
Pengaruh Susu Kacang Kedelai (GLYCINE MAX (L.) MERR.) Terhadap Kualitas Spermatozoa Tikus Wistar (Rattus Norvegicus)
Pengaruh Susu Kacang Kedelai (GLYCINE MAX (L.) MERR.) Terhadap Kualitas Spermatozoa Tikus Wistar (Rattus Norvegicus)
Abstract: The effects of soy beans on spermatozoa still been a controversial thing. Soy is one of the source of the Fitoestrogen because the structure isoflavon of soy is similar w...

Back to Top