Javascript must be enabled to continue!
Growth Characteristic and the Study of Polymorphism Growth Hormone Genes of Sentul Chicken
View through CrossRef
The research was conducted to study the characteristics of growth, carcass production and growth hormone gene polymorphisms in various male sentul chickens. The research was conducted using experimental methods with a completely randomized design. The research material was 100 male day old chickens of Sentul. The treatment was a fixed factor, namely the variation of the color of the feathers of various Sentul chickens consisting of: “Abu” Sentul, “Emas” Sentul, “Geni” Sentul, “Debu” Sentul, “Batu” Sentul.. Each experimental unit consisted of 5 chickens and 4 replications. The variables measured included: hatching weight, body weight, body weight gain and the percentage of carcass produced at the age of 8 weeks. Identification of growth hormone gene polymorphisms used the primary design Gallus gallus haplotype GH-h22 growth hormone (GH) gene, complete cds, GenBank: JN675393.1 with forward primer / Sequence: AGGTGGTTCGGTTTTCACTG and reverse primer / Sequence: TCCCTTCTTCCAGGTCCTTT. Characteristics of growth and carcass production data were analyzed by analysis of variance; while to determine the presence of GH gene, polymorphisms were analyzed using the bioedit program. Analysis of variance showed that there were no significant differences (P> 0.05) between hatching weight, body weight, body weight gain and carcass percentage of various Sentul chickens. The results of GH Gallus gallus gene sequencing at base length 80 bp showed a mutation from adinine to cytosine, when comparing sentul chickens and Gallus gallus data in GenBank. The GH gene were present in various sentul chickens with monomorphic characteristics with homozygous genotypes of CC. The results of this study can be concluded that the characteristics of growth and carcass production in various Sentul chickens are relatively the same, as well as the monomorphic GH gene.
Keywords: Sentul chickens, body weight, carcass percentage, growth hormone gene, monomorphic.
Title: Growth Characteristic and the Study of Polymorphism Growth Hormone Genes of Sentul Chicken
Description:
The research was conducted to study the characteristics of growth, carcass production and growth hormone gene polymorphisms in various male sentul chickens.
The research was conducted using experimental methods with a completely randomized design.
The research material was 100 male day old chickens of Sentul.
The treatment was a fixed factor, namely the variation of the color of the feathers of various Sentul chickens consisting of: “Abu” Sentul, “Emas” Sentul, “Geni” Sentul, “Debu” Sentul, “Batu” Sentul.
Each experimental unit consisted of 5 chickens and 4 replications.
The variables measured included: hatching weight, body weight, body weight gain and the percentage of carcass produced at the age of 8 weeks.
Identification of growth hormone gene polymorphisms used the primary design Gallus gallus haplotype GH-h22 growth hormone (GH) gene, complete cds, GenBank: JN675393.
1 with forward primer / Sequence: AGGTGGTTCGGTTTTCACTG and reverse primer / Sequence: TCCCTTCTTCCAGGTCCTTT.
Characteristics of growth and carcass production data were analyzed by analysis of variance; while to determine the presence of GH gene, polymorphisms were analyzed using the bioedit program.
Analysis of variance showed that there were no significant differences (P> 0.
05) between hatching weight, body weight, body weight gain and carcass percentage of various Sentul chickens.
The results of GH Gallus gallus gene sequencing at base length 80 bp showed a mutation from adinine to cytosine, when comparing sentul chickens and Gallus gallus data in GenBank.
The GH gene were present in various sentul chickens with monomorphic characteristics with homozygous genotypes of CC.
The results of this study can be concluded that the characteristics of growth and carcass production in various Sentul chickens are relatively the same, as well as the monomorphic GH gene.
Keywords: Sentul chickens, body weight, carcass percentage, growth hormone gene, monomorphic.
Related Results
KADAR KOLESTEROL, UREA, KREATININ DARAH DAN KOLESTEROL TELUR AYAM SENTUL DENGAN PENAMBAHAN EKSTRAK BUAH MENGKUDU YANG DISUPLEMENTASI Cu DAN Zn
KADAR KOLESTEROL, UREA, KREATININ DARAH DAN KOLESTEROL TELUR AYAM SENTUL DENGAN PENAMBAHAN EKSTRAK BUAH MENGKUDU YANG DISUPLEMENTASI Cu DAN Zn
The research was conducted to know the effect of noni fruit extract supplemented by Cu and Zn on blood cholesterol and egg yolk cholesterol, creatinin, and blood urea nitrogen of ...
Effect of albumen width, albumen height, and albumen index on haugh unit of sentul chicken eggs
Effect of albumen width, albumen height, and albumen index on haugh unit of sentul chicken eggs
Haugh unit is one of the indicators that determine albumen quality. This study aims to know the correlation and the magnitude of the effect of albumen width, albumen height, and al...
Antibacterial activity of Sentul fruit peel extract (Sandoricum koetjape) against Streptococcus mutans and Staphylococcus aureus
Antibacterial activity of Sentul fruit peel extract (Sandoricum koetjape) against Streptococcus mutans and Staphylococcus aureus
Introduction: Infectious mouth diseases are caused by microorganisms such as Staphylococcus aureus and Streptococcus mutans. Sentul fruit peel extract contains several phytoch...
Growth of chicks of various superior strains resulting from artificial insemination in Kendari city
Growth of chicks of various superior strains resulting from artificial insemination in Kendari city
Abstract
Local chickens in Indonesia consist of some strains, including native chicken, ULU chicken, Sensi chicken, Elba chicken, KUB chicken, Arab chicken, Bangkok ...
Genotyping Method and Frequency of ADRB3-rs4994 Single Nucleotide Polymorphism Genotypes in Hanoi 3-5 Years Old Chidren
Genotyping Method and Frequency of ADRB3-rs4994 Single Nucleotide Polymorphism Genotypes in Hanoi 3-5 Years Old Chidren
The Trp64Arg (rs4994) polymorphism in codon 64 of ADRB3 (beta3-adrenergic receptor) gene is involved in the regulation of energy metabolism. This study optimizes the genotyping met...
Action of Chicken II GnRH on the Human Placenta1
Action of Chicken II GnRH on the Human Placenta1
The stability, receptor binding, bioactivity, and production of chicken II GnRH and its analogs in the human placenta were studied. Both chicken II and mammalian GnRH are rapidly d...
P-439 Role of Growth hormone in increasing the endometrial receptivity in aged women with thin endometrium undergoing Frozen embryo transfer cycle
P-439 Role of Growth hormone in increasing the endometrial receptivity in aged women with thin endometrium undergoing Frozen embryo transfer cycle
Abstract
Study question
Is there a role for Growth hormone in increasing the clinical pregnancy rate by increasing the endometri...
Design and Fabrication of Automatic Temperature Control for Chicken Shade
Design and Fabrication of Automatic Temperature Control for Chicken Shade
One of the most crucial sectors to explore in Malaysia are agriculture and poultry. Indeed, there is a strong correlation between agricultural growth and economic growth. The incon...

