Growth Characteristic and the Study of Polymorphism Growth Hormone Genes of Sentul Chicken

The research was conducted to study the characteristics of growth, carcass production and growth hormone gene polymorphisms in various male sentul chickens. The research was conducted using experimental methods with a completely randomized design. The research material was 100 male day old chickens of Sentul. The treatment was a fixed factor, namely the variation of the color of the feathers of various Sentul chickens consisting of: “Abu” Sentul, “Emas” Sentul, “Geni” Sentul, “Debu” Sentul, “Batu” Sentul.. Each experimental unit consisted of 5 chickens and 4 replications. The variables measured included: hatching weight, body weight, body weight gain and the percentage of carcass produced at the age of 8 weeks. Identification of growth hormone gene polymorphisms used the primary design Gallus gallus haplotype GH-h22 growth hormone (GH) gene, complete cds, GenBank: JN675393.1 with forward primer / Sequence: AGGTGGTTCGGTTTTCACTG and reverse primer / Sequence: TCCCTTCTTCCAGGTCCTTT. Characteristics of growth and carcass production data were analyzed by analysis of variance; while to determine the presence of GH gene, polymorphisms were analyzed using the bioedit program. Analysis of variance showed that there were no significant differences (P> 0.05) between hatching weight, body weight, body weight gain and carcass percentage of various Sentul chickens. The results of GH Gallus gallus gene sequencing at base length 80 bp showed a mutation from adinine to cytosine, when comparing sentul chickens and Gallus gallus data in GenBank. The GH gene were present in various sentul chickens with monomorphic characteristics with homozygous genotypes of CC. The results of this study can be concluded that the characteristics of growth and carcass production in various Sentul chickens are relatively the same, as well as the monomorphic GH gene. Keywords: Sentul chickens, body weight, carcass percentage, growth hormone gene, monomorphic.