Javascript must be enabled to continue!
Treseder Lab Pyrosequencing Protocol v1
View through CrossRef
DNA Extraction Extract DNA from sample using the phenol/chloroform procedure or your kit of choice. We typically use the Mo Bio Power Soil DNA extraction kit for extracting DNA from soil and plant litter samples. Use the Nanodrop in the Martiny lab to estimate the concentration and purity of your DNA extraction. Dilute DNA to 10 ng/ul prior to PCR. PCR Amplification Pre-amplification checklist: All pipetting should be done with aerosol barrier, PCR certified pipet tips in a PCR work station On ice thaw primers, DNA and PCR master mix Decontaminate pipettors and interior surfaces of a PCR workstation with DNA/RNA Away or 10% bleach solution. UV irradiate PCR work station interior, pipettors and consumables for minimum 15 min All samples should be amplified in triplicate. Include negative (no template) and positive (DNA isolated from mushroom) controls. Primer information: Forward primer: 454 primer B + 'AG' linker + SSU817f GCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGA Reverse Primer: 454 primer A + 12-base bar code + 'AC' linker + ssu1196r GCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCC Example barcode: ACACACTATGGC Example primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCC PCR Cocktail: 22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix) 1 ul BSA 0.75 ul 10 uM forward primer (all samples get the same forward primer) 0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer) 1 ul template DNA PCR cycle: Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon Cleaning Combine the triplicate PCR reactions into a single volume Clean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon Quantification Use the qubit system for quantifying DNA, with a few modifications. Instead of using the qubit assay tubes, prepare the samples in black microplates. Perform assay with 1 ul of PCR product Read the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon Pooling Combine equal amounts of DNA per sample into single vessel (usually a 15 mL tube). Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kit Run a gel to visualize pooled samples Depending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purity Use the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing. Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencing Send samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment. Send samples overnight on dry ice
Title: Treseder Lab Pyrosequencing Protocol v1
Description:
DNA Extraction Extract DNA from sample using the phenol/chloroform procedure or your kit of choice.
We typically use the Mo Bio Power Soil DNA extraction kit for extracting DNA from soil and plant litter samples.
Use the Nanodrop in the Martiny lab to estimate the concentration and purity of your DNA extraction.
Dilute DNA to 10 ng/ul prior to PCR.
PCR Amplification Pre-amplification checklist: All pipetting should be done with aerosol barrier, PCR certified pipet tips in a PCR work station On ice thaw primers, DNA and PCR master mix Decontaminate pipettors and interior surfaces of a PCR workstation with DNA/RNA Away or 10% bleach solution.
UV irradiate PCR work station interior, pipettors and consumables for minimum 15 min All samples should be amplified in triplicate.
Include negative (no template) and positive (DNA isolated from mushroom) controls.
Primer information: Forward primer: 454 primer B + 'AG' linker + SSU817f GCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGA Reverse Primer: 454 primer A + 12-base bar code + 'AC' linker + ssu1196r GCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCC Example barcode: ACACACTATGGC Example primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCC PCR Cocktail: 22.
5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix) 1 ul BSA 0.
75 ul 10 uM forward primer (all samples get the same forward primer) 0.
75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer) 1 ul template DNA PCR cycle: Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec.
A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region.
Check for PCR product on a gel Amplicon Cleaning Combine the triplicate PCR reactions into a single volume Clean PCR reactions with a PCR clean up kit.
The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well.
Amplicon Quantification Use the qubit system for quantifying DNA, with a few modifications.
Instead of using the qubit assay tubes, prepare the samples in black microplates.
Perform assay with 1 ul of PCR product Read the plates on the microplate reader in the Allison lab set at 485ex /530em.
Estimate amplicon concentration using the standard curve.
Amplicon Pooling Combine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).
Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kit Run a gel to visualize pooled samples Depending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons.
Pyrosequencing is biased towards shorter reads.
If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive.
We used the Qiagen QIAquick Gel Extraction Kit.
We ran samples out on a 1.
4 % gel.
The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample.
You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing.
Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit.
Estimate final sample concentration and purity Use the qubit system for estimating sample concentration.
The sequencing facility requires 2-3 ug of DNA for sequencing.
Use the Nanodrop in the Martiny lab for estimating sample purity.
Samples with an A260/A280 ratio of ~1.
8 typically provide optimal sequencing results.
Send sample for sequencing Send samples to the Engencore sequencing facility at the University of South Carolina.
Check their website for more specific details about what else to include in the shipment.
Send samples overnight on dry ice.
Related Results
Innovate dementia: the development of a living lab protocol to evaluate interventions in context
Innovate dementia: the development of a living lab protocol to evaluate interventions in context
Purpose
– The purpose of this paper is to propose a Living Lab protocol to evaluate interventions for people with dementia in context. The number of people with dem...
Comparison of Interpretation between Pyrosequencing and Xpert MTB/RIF Assay in Multidrug-Resistant Tuberculosis
Comparison of Interpretation between Pyrosequencing and Xpert MTB/RIF Assay in Multidrug-Resistant Tuberculosis
Indonesia is one of the countries with the highest multidrug-resistant tuberculosis cases in the world. Rapid molecular test using the Xpert MTB/RIF assay is one of the detection m...
Identification of Alpha-Hemolytic Streptococci by Pyrosequencing the 16S rRNA Gene and by Use of VITEK 2
Identification of Alpha-Hemolytic Streptococci by Pyrosequencing the 16S rRNA Gene and by Use of VITEK 2
ABSTRACTAlpha-hemolytic streptococci are very difficult to identify by phenotypic methods. In this study, a pyrosequencing method for the identification of streptococcal species ba...
Al for Chattogram Veterinary and Animal Sciences University's lab and production enhancement
Al for Chattogram Veterinary and Animal Sciences University's lab and production enhancement
Al for Chattogram Veterinary and Animal Sciences University's lab and production enhancement Al for Chattogram Veterinary and Animal Sciences University's lab and production enhanc...
Position-specific automated processing of V3 env ultra-deep pyrosequencing data for predicting HIV-1 tropism
Position-specific automated processing of V3 env ultra-deep pyrosequencing data for predicting HIV-1 tropism
AbstractHIV-1 coreceptor usage must be accurately determined before starting CCR5 antagonist-based treatment as the presence of undetected minor CXCR4-using variants can cause subs...
Rapid identification of nine species of diphyllobothriidean tapeworms by pyrosequencing
Rapid identification of nine species of diphyllobothriidean tapeworms by pyrosequencing
AbstractThe identification of diphyllobothriidean tapeworms (Cestoda: Diphyllobothriidea) that infect humans and intermediate/paratenic hosts is extremely difficult due to their mo...
A183 SECRETIONS OF LACTIC ACID BACTERIA AS ANTI-HELICOBACTER PYLORI AGENTS
A183 SECRETIONS OF LACTIC ACID BACTERIA AS ANTI-HELICOBACTER PYLORI AGENTS
Abstract
Background
Helicobacter pylori (HP) colonizes chronically 50% of the world population, leading to gastric ulcers or can...
Verification of High Speed on Chip with VIP using System Verilog
Verification of High Speed on Chip with VIP using System Verilog
Abstract - The exploration work is addressing verification of High speed on chips protocol; we've used the system Verilog grounded test bench structure. I developed a system Verilo...

