Search engine for discovering works of Art, research articles, and books related to Art and Culture
ShareThis
Javascript must be enabled to continue!

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences

View through CrossRef
amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.
Title: Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences
Description:
amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B.
subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4.
The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.
3-kilobase insert of pTUB4.
Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined.
Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids).
Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA.
The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110.
The electrophoretic mobility in a 7.
5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases.
The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al.
, Biochem.
Biophys.
Res.
Commun.
112:687-683, 1983).
The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.
2 kcal/mol (-34.
3 kJ/mol) were identified.
The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character.
The nucleotide sequence around the region was quite different from the promoter region of the B.
subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.

Related Results

North Syrian Mortaria and Other Late Roman Personal and Utility Objects Bearing Inscriptions of Good Luck
North Syrian Mortaria and Other Late Roman Personal and Utility Objects Bearing Inscriptions of Good Luck
<span style="font-size: 11pt; color: black; font-family: 'Times New Roman','serif'">&Pi;&Eta;&Lambda;&Iota;&Nu;&Alpha; &Iota;&Gamma;&Delta...
The gene amyE(TV1) codes for a nonglucogenic alpha-amylase from Thermoactinomyces vulgaris 94-2A in Bacillus subtilis
The gene amyE(TV1) codes for a nonglucogenic alpha-amylase from Thermoactinomyces vulgaris 94-2A in Bacillus subtilis
We isolated the gene amyE(TV1) from Thermoactinomyces vulgaris 94-2A encoding a nonglucogenic alpha-amylase (AmyTV1). A chromosomal DNA fragment of 2,247 bp contained an open readi...
Un manoscritto equivocato del copista santo Theophilos († 1548)
Un manoscritto equivocato del copista santo Theophilos († 1548)
<p><font size="3"><span class="A1"><span style="font-family: 'Times New Roman','serif'">&Epsilon;&Nu;&Alpha; &Lambda;&Alpha;&Nu;&...
Cloning and expression of maltooligosyltrehalose trehalohydrolase from Sulfolobus solfataricus DSM 1616 in Bacillus subtilis WB800
Cloning and expression of maltooligosyltrehalose trehalohydrolase from Sulfolobus solfataricus DSM 1616 in Bacillus subtilis WB800
Maltooligosyltrehalose trehalohydrolase (MTHase) is an industrial enzyme for the production of trehalose. A DNA fragment of 1680 bp encoding for MTHase was cloned from Sulfobolus s...
Response of Bacillus megaterium and Bacillus mucilaginosus Strains on Yield and Quality of Soybean
Response of Bacillus megaterium and Bacillus mucilaginosus Strains on Yield and Quality of Soybean
At present due to continuous use of phosphatic and potassic fertilizers a deposits of these nutrient have increased in the soil of studied area, and Bacillus megaterium and Bacillu...
Whole genome assembly of a natto production strain Bacillus subtilis natto from very short read data
Whole genome assembly of a natto production strain Bacillus subtilis natto from very short read data
Abstract Background Bacillus subtilis natto is closely related to the laboratory standard strain B. subtilis Marburg 168, and func...
Amplification and deletion of the amyE+-tmrB+ gene region in a Bacillus subtilis recombinant-phage genome by the tmrA7 mutation
Amplification and deletion of the amyE+-tmrB+ gene region in a Bacillus subtilis recombinant-phage genome by the tmrA7 mutation
A 22.4-kilobase DNA fragment containing the tmrA7-amyR2-amyE+-tmrB+-aroI+ region of the Bacillus subtilis N7 chromosomal DNA was cloned into a recombinant B. subtilis bacteriophage...

Back to Top