Search engine for discovering works of Art, research articles, and books related to Art and Culture
ShareThis
Javascript must be enabled to continue!

Morphlogical and Molecular Characterization of Rotylenchulus borealis Loof and Oostenbrink, 1962 from Turkey

View through CrossRef
Reniform nematodes (Rotylenchulus spp.) have been reported to be associated with a large number of important products all over the world, ranging from important cereals, vegetables and ornamental plants. In this study, morphologic and molecular characters were used to idetify Rotylenchulus population obtained from a soybean field in Adana province of Turkey. Nematodes were extracted from the soil using a modified baermann funnel method. The morphological characters and morphometrics of male and immature females were examined and compared with previous studies. For molecular characterisation, DNA was extracted from immature females and the D2-D3 expansion region of the 28S rRNA gene was amplified using primer pair D2A (5’ACA AGTACCGTGAGGGAAAGTTG 3’) and D3B (5’ TCGGAAGGAACCAGCTACTA 3’). PCR product (780 bp) was sequenced and then compared with sequences of Rotylenchulus species available in the GenBank database. The result obtained from morphologic and molecular studies showed that the reniform nematode population was Rotylenchulus borealis.
Title: Morphlogical and Molecular Characterization of Rotylenchulus borealis Loof and Oostenbrink, 1962 from Turkey
Description:
Reniform nematodes (Rotylenchulus spp.
) have been reported to be associated with a large number of important products all over the world, ranging from important cereals, vegetables and ornamental plants.
In this study, morphologic and molecular characters were used to idetify Rotylenchulus population obtained from a soybean field in Adana province of Turkey.
Nematodes were extracted from the soil using a modified baermann funnel method.
The morphological characters and morphometrics of male and immature females were examined and compared with previous studies.
For molecular characterisation, DNA was extracted from immature females and the D2-D3 expansion region of the 28S rRNA gene was amplified using primer pair D2A (5’ACA AGTACCGTGAGGGAAAGTTG 3’) and D3B (5’ TCGGAAGGAACCAGCTACTA 3’).
PCR product (780 bp) was sequenced and then compared with sequences of Rotylenchulus species available in the GenBank database.
The result obtained from morphologic and molecular studies showed that the reniform nematode population was Rotylenchulus borealis.

Related Results

Current Perspectives on Cystic Echinococcosis: A Systematic Review
Current Perspectives on Cystic Echinococcosis: A Systematic Review
Abstract Introduction: Hydatidosis, a zoonotic disease caused by the larval stage of Echinococcus granulosus, is a significant public health concern with notable economic impact. I...
Hydatid Disease of The Brain Parenchyma: A Systematic Review
Hydatid Disease of The Brain Parenchyma: A Systematic Review
Abstarct Introduction Isolated brain hydatid disease (BHD) is an extremely rare form of echinococcosis. A prompt and timely diagnosis is a crucial step in disease management. This ...
Chest Wall Hydatid Cysts: A Systematic Review
Chest Wall Hydatid Cysts: A Systematic Review
Abstract Introduction Given the rarity of chest wall hydatid disease, information on this condition is primarily drawn from case reports. Hence, this study systematically reviews t...
Turkey’s July 15th Coup: What Happened and Why
Turkey’s July 15th Coup: What Happened and Why
This book is a collection of essays written by a variety of experts on Turkey and social movements and provides a critical analysis of the role of the Gülen Movement (GM)—or Hizmet...
PATHOGENICITY OF RENIFORM NEMATODE (ROTYLENCHULUS RENIFORMIS, LINFORD AND OLIVEIRA, 1960) ON COWPEA (VIGNA UNGUICULATA)
PATHOGENICITY OF RENIFORM NEMATODE (ROTYLENCHULUS RENIFORMIS, LINFORD AND OLIVEIRA, 1960) ON COWPEA (VIGNA UNGUICULATA)
– Studies on the pathogenicity of reniform nematode (Rotylenchulus reniformis Linford & Oliveira, 1940) on cowpea (Vigna unguiculata) under greenhouse conditions showed that th...
A molecular dynamic study of Soil Organic Matter stabilization mechanisms
A molecular dynamic study of Soil Organic Matter stabilization mechanisms
<p>It is well known that some fractions of soil organic matter (SOM) can resist to physical and (bio)chemical degradation which can be attributed to factors ranging f...
Turkey and the European Union: the Saga of the 50 Years-Long Accession Negotiations
Turkey and the European Union: the Saga of the 50 Years-Long Accession Negotiations
The EU-Turkey relations date back to 1960s when the European project started. With the Ankara Agreement of 12 September 1963, Turkey became an Associate member of the European Econ...

Back to Top