Javascript must be enabled to continue!
Evidence based distribution of protamine 2 genes polymorphism variants in infertile and fertile males in Southwestern Nigeria.
View through CrossRef
Protamine 2 is a major core protein of spermatozoa and is important for maintaining male fertility. The aim of the study was to determine the distribution of protamine 2 gene polymorphisms variants in infertile males in Southwestern Part of Nigeria. This is a cross sectional study, consisted of volunteered infertile and fertile male attendees of known Fertility Clinics in Lagos Metropolis, Lagos, Nigeria. The infertile male subjects recruited, were fifty-seven (57) in number and the fertile male subjects (control) were thirty-five in number (35) and were within the age range of 30-59 years old. Semen specimen was collected from each subject in line with WHO guideline for semen analysis into sterile semen containers through masturbation. Sperm DNA from subjects’ sperm cells was extracted by chemical method (protein kinase buffer), quantified using nanodrop 1000 Spectrophotometer and amplified using the PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3’ PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -3' primers on an ABI 9700 Applied Biosystem thermal cycler at final volume of 25 µL for 35 cycles. Sequencing was done using the BigDye Terminator kit on a 3510 ABI sequencer. The results of genetic testing on the flank; 5’-UTR of the PRM 2 gene showed the following variants with polymorphisms and frequencies as follow: rs2069880951 (A>T /T>A) 6 (6.6%), rs1382451565 (C>T) 5 (5.4%), and rs935520555 (G>C) 5 (5.4%), rs1479789045 (G/C>A/ A>G) 4 (4.3%), rs570570800 (C>T/ G>T) 3 (3.3%), rs1281533806 (C>A) 3 (3.3%), rs1434703461 (C>T/ G>T) 3 (3.3%), rs2069881018 (G>C) 3 (3.3%), rs549835830 (G>C) 2 (2.2%), rs2069880888( C>T ) 2 (2.2%), rs997110743 (G>C/C>G), rs1236501997 1 (1.1%), rs119399669 (C>T) 1 (1.1%), and rs1052575569 (G>A/C>A) 1 (1.1%). In this study, there were novel variants of protamine 2 gene polymorphism, identified with reference to the reference sequence of NCBI data base in the infertile and fertile male subjects.
Title: Evidence based distribution of protamine 2 genes polymorphism variants in infertile and fertile males in Southwestern Nigeria.
Description:
Protamine 2 is a major core protein of spermatozoa and is important for maintaining male fertility.
The aim of the study was to determine the distribution of protamine 2 gene polymorphisms variants in infertile males in Southwestern Part of Nigeria.
This is a cross sectional study, consisted of volunteered infertile and fertile male attendees of known Fertility Clinics in Lagos Metropolis, Lagos, Nigeria.
The infertile male subjects recruited, were fifty-seven (57) in number and the fertile male subjects (control) were thirty-five in number (35) and were within the age range of 30-59 years old.
Semen specimen was collected from each subject in line with WHO guideline for semen analysis into sterile semen containers through masturbation.
Sperm DNA from subjects’ sperm cells was extracted by chemical method (protein kinase buffer), quantified using nanodrop 1000 Spectrophotometer and amplified using the PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3’ PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -3' primers on an ABI 9700 Applied Biosystem thermal cycler at final volume of 25 µL for 35 cycles.
Sequencing was done using the BigDye Terminator kit on a 3510 ABI sequencer.
The results of genetic testing on the flank; 5’-UTR of the PRM 2 gene showed the following variants with polymorphisms and frequencies as follow: rs2069880951 (A>T /T>A) 6 (6.
6%), rs1382451565 (C>T) 5 (5.
4%), and rs935520555 (G>C) 5 (5.
4%), rs1479789045 (G/C>A/ A>G) 4 (4.
3%), rs570570800 (C>T/ G>T) 3 (3.
3%), rs1281533806 (C>A) 3 (3.
3%), rs1434703461 (C>T/ G>T) 3 (3.
3%), rs2069881018 (G>C) 3 (3.
3%), rs549835830 (G>C) 2 (2.
2%), rs2069880888( C>T ) 2 (2.
2%), rs997110743 (G>C/C>G), rs1236501997 1 (1.
1%), rs119399669 (C>T) 1 (1.
1%), and rs1052575569 (G>A/C>A) 1 (1.
1%).
In this study, there were novel variants of protamine 2 gene polymorphism, identified with reference to the reference sequence of NCBI data base in the infertile and fertile male subjects.
Related Results
Single nucleotide polymorphisms in protamine 2 genes in fertile and infertile human males in Southwest, Nigeria
Single nucleotide polymorphisms in protamine 2 genes in fertile and infertile human males in Southwest, Nigeria
It is reported that variations in the nucleotide sequence of protamine genes play contributory role in men’s fertility. The aim of this study was to evaluate single nucleotide poly...
Protamine inhibits platelet derived growth factor receptor activity but not epidermal growth factor activity
Protamine inhibits platelet derived growth factor receptor activity but not epidermal growth factor activity
AbstractProtamine sulfate blocked 125I‐PDGF binding to its specific physiological receptor on Swiss mouse 3T3 cells. Reduced 125I‐PDGF binding in the presence of protamine sulfate ...
Behavioural Dimorphism in Male Ruffs, Philomachus Pugnax (L.)
Behavioural Dimorphism in Male Ruffs, Philomachus Pugnax (L.)
AbstractIn the Ruff two groups of males can be distinguished: independent males and satellite males. This classification is based upon differences in territoriality and behaviour, ...
Heparin-protamine management: a comparison study of three different heparin-protamine management protocols
Heparin-protamine management: a comparison study of three different heparin-protamine management protocols
In a prospective randomized open study, 180 patients underwent open-heart surgery using cardiopulmonary bypass (CPB) and were divided into three different heparin-protamine managem...
Optimal Protamine Dosing for Heparin Reversal in Cardiopulmonary Bypass: A Quasi-Experimental Study in Elective Coronary Artery Bypass Surgery
Optimal Protamine Dosing for Heparin Reversal in Cardiopulmonary Bypass: A Quasi-Experimental Study in Elective Coronary Artery Bypass Surgery
Objectives: Protamine sulfate is routinely administered after cardiopulmonary bypass (CPB) to neutralize heparin; however, conventional 1:1 heparin–protamine dosing may exceed the ...
Contributory Effect of Adenosine Triphosphate (ATP) To Male Infertility
Contributory Effect of Adenosine Triphosphate (ATP) To Male Infertility
Infertility comes at a cost to the couples/spouses as the associated trauma ranges from depression to rejection, emotional imbalance to mention a few. Adenosine triphosphate (ATP) ...
Abstract 12642: Protamine Administration in Patients Undergoing Percutaneous Left Atrial Appendage Occlusion
Abstract 12642: Protamine Administration in Patients Undergoing Percutaneous Left Atrial Appendage Occlusion
Introduction:
Intravenous protamine sulfate is widely used to reverse anticoagulation after structural heart interventions. Protamine is currently designated as in shor...
Comparison of vitamin D (25OHD) status between fertile and infertile men
Comparison of vitamin D (25OHD) status between fertile and infertile men
Background: Vitamin D (25OHD) deficiency has become a modern-day epidemic, being the most common nutritional deficiency worldwide. Many infertile men are experiencing low total spe...

