Evidence based distribution of protamine 2 genes polymorphism variants in infertile and fertile males in Southwestern Nigeria.

Protamine 2 is a major core protein of spermatozoa and is important for maintaining male fertility. The aim of the study was to determine the distribution of protamine 2 gene polymorphisms variants in infertile males in Southwestern Part of Nigeria. This is a cross sectional study, consisted of volunteered infertile and fertile male attendees of known Fertility Clinics in Lagos Metropolis, Lagos, Nigeria. The infertile male subjects recruited, were fifty-seven (57) in number and the fertile male subjects (control) were thirty-five in number (35) and were within the age range of 30-59 years old. Semen specimen was collected from each subject in line with WHO guideline for semen analysis into sterile semen containers through masturbation. Sperm DNA from subjects’ sperm cells was extracted by chemical method (protein kinase buffer), quantified using nanodrop 1000 Spectrophotometer and amplified using the PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3’ PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -3' primers on an ABI 9700 Applied Biosystem thermal cycler at final volume of 25 µL for 35 cycles. Sequencing was done using the BigDye Terminator kit on a 3510 ABI sequencer. The results of genetic testing on the flank; 5’-UTR of the PRM 2 gene showed the following variants with polymorphisms and frequencies as follow: rs2069880951 (A>T /T>A) 6 (6.6%), rs1382451565 (C>T) 5 (5.4%), and rs935520555 (G>C) 5 (5.4%), rs1479789045 (G/C>A/ A>G) 4 (4.3%), rs570570800 (C>T/ G>T) 3 (3.3%), rs1281533806 (C>A) 3 (3.3%), rs1434703461 (C>T/ G>T) 3 (3.3%), rs2069881018 (G>C) 3 (3.3%), rs549835830 (G>C) 2 (2.2%), rs2069880888( C>T ) 2 (2.2%), rs997110743 (G>C/C>G), rs1236501997 1 (1.1%), rs119399669 (C>T) 1 (1.1%), and rs1052575569 (G>A/C>A) 1 (1.1%). In this study, there were novel variants of protamine 2 gene polymorphism, identified with reference to the reference sequence of NCBI data base in the infertile and fertile male subjects.