Javascript must be enabled to continue!
A Whole Exome Sequencing Study of a small Indian Autosomal Dominant Polycystic Kidney Disease Patient Cohort
View through CrossRef
Abstract
Autosomal Dominant Polycystic Kidney Disease is characterized by renal cyst development, often leading to kidney enlargement and failure. We conducted whole exome sequencing on 14 participants (12 families) from an Indian cohort. Our analysis revealed a spectrum of genetic variants, predominantly in the
PKD1.
These in
PKD1
included missense variants such as p.Glu2937Lys (c.8809G>A) and p.Gly2310Arg (c.6928G>A), p.Asp2095Gly (c.6284A>G), p.Thr938Met (c.2813C>T), p.Trp967Arg (c.2899T>C), p.Glu593* (c.1777G>T), frameshift variants p.Gln149fs*141 (c.445delC), p.Ser3305fs*84 (c.9914_9915delCT), p.His1347fs*83 (c.4041_4042delCA), and p.Leu2776fs*87(c.8327_8363delTGGCGGGCGAGGAGATCGTGGCCCAGGGCAAGCGCTC), intronic splice site variant c.8017-3C>G, nonsense variant p.Glu593* (c.1777G>T) and in
PKD2
missense variant p.Ser370Asn (c.1109G>A). While one individual carried intronic (c.2358+5G>A) and 3’UTR (c.*174G>T) variants in
PKD2
only another individual carried variants in both
PKD1
and
PKD2
, suggesting potential genetic complexity. Clinical data revealed diverse presentations. Age at diagnosis varied widely. Patients with frameshift variants exhibited earlier onset and severe manifestations, including bilateral ADPKD. One proband had right unilateral ADPKD. Involvement of liver, a common extra-renal manifestation, was also observed. Heterogeneity at phenotypic and at allelic level was observed in our cohort. In this study, using WES of a trio, a frameshift-truncation deletion [c.32del/p.Leu11ArgfsTer61] in
MIOX
was found to be associated with the disease shared by both the affected and early diagnosed mother and daughter carrying
PKD1
missense variant, which had not been previously reported in ADPKD. Further, differential gene expression analysis using data from GEO database showed reduced MIOX expression in ADPKD cystic samples compared to minimal cystic tissues and controls. MIOX is an enzyme specific to renal tubules and catalyses the initial step of the kidney-based myoinositol catabolism. Both affected candidates also shared benign variants and other variations of uncertain significance which may influence the disease development. Further functional analysis will clarify how MIOX contributes to the disease. The study limitations include the small sample size and the need for validation in larger cohorts. Our findings highlight the importance of genetic analysis in ADPKD management especially to facilitate personalized therapeutic strategies.
Highlights
Identified variants in
PKD1
and
PKD2
through whole exome sequencing in ADPKD patients, affecting different protein regions.
Variants include non-synonymous coding changes, frame-shift deletions, and splice site alterations.
Clinical features and age at diagnosis varied widely, with common symptoms including flank pain, fatigue.
Frameshift deletion in
MIOX
, associated in one PKD1 trio, implicates its role in ADPKD pathogenesis.
DGE analysis of dataset from database reveals downregulation of MIOX in ADPKD tissue samples highlighting its role in potential molecular pathways in ADPKD progression.
Graphical abstract
Title: A Whole Exome Sequencing Study of a small Indian Autosomal Dominant Polycystic Kidney Disease Patient Cohort
Description:
Abstract
Autosomal Dominant Polycystic Kidney Disease is characterized by renal cyst development, often leading to kidney enlargement and failure.
We conducted whole exome sequencing on 14 participants (12 families) from an Indian cohort.
Our analysis revealed a spectrum of genetic variants, predominantly in the
PKD1.
These in
PKD1
included missense variants such as p.
Glu2937Lys (c.
8809G>A) and p.
Gly2310Arg (c.
6928G>A), p.
Asp2095Gly (c.
6284A>G), p.
Thr938Met (c.
2813C>T), p.
Trp967Arg (c.
2899T>C), p.
Glu593* (c.
1777G>T), frameshift variants p.
Gln149fs*141 (c.
445delC), p.
Ser3305fs*84 (c.
9914_9915delCT), p.
His1347fs*83 (c.
4041_4042delCA), and p.
Leu2776fs*87(c.
8327_8363delTGGCGGGCGAGGAGATCGTGGCCCAGGGCAAGCGCTC), intronic splice site variant c.
8017-3C>G, nonsense variant p.
Glu593* (c.
1777G>T) and in
PKD2
missense variant p.
Ser370Asn (c.
1109G>A).
While one individual carried intronic (c.
2358+5G>A) and 3’UTR (c.
*174G>T) variants in
PKD2
only another individual carried variants in both
PKD1
and
PKD2
, suggesting potential genetic complexity.
Clinical data revealed diverse presentations.
Age at diagnosis varied widely.
Patients with frameshift variants exhibited earlier onset and severe manifestations, including bilateral ADPKD.
One proband had right unilateral ADPKD.
Involvement of liver, a common extra-renal manifestation, was also observed.
Heterogeneity at phenotypic and at allelic level was observed in our cohort.
In this study, using WES of a trio, a frameshift-truncation deletion [c.
32del/p.
Leu11ArgfsTer61] in
MIOX
was found to be associated with the disease shared by both the affected and early diagnosed mother and daughter carrying
PKD1
missense variant, which had not been previously reported in ADPKD.
Further, differential gene expression analysis using data from GEO database showed reduced MIOX expression in ADPKD cystic samples compared to minimal cystic tissues and controls.
MIOX is an enzyme specific to renal tubules and catalyses the initial step of the kidney-based myoinositol catabolism.
Both affected candidates also shared benign variants and other variations of uncertain significance which may influence the disease development.
Further functional analysis will clarify how MIOX contributes to the disease.
The study limitations include the small sample size and the need for validation in larger cohorts.
Our findings highlight the importance of genetic analysis in ADPKD management especially to facilitate personalized therapeutic strategies.
Highlights
Identified variants in
PKD1
and
PKD2
through whole exome sequencing in ADPKD patients, affecting different protein regions.
Variants include non-synonymous coding changes, frame-shift deletions, and splice site alterations.
Clinical features and age at diagnosis varied widely, with common symptoms including flank pain, fatigue.
Frameshift deletion in
MIOX
, associated in one PKD1 trio, implicates its role in ADPKD pathogenesis.
DGE analysis of dataset from database reveals downregulation of MIOX in ADPKD tissue samples highlighting its role in potential molecular pathways in ADPKD progression.
Graphical abstract.
Related Results
Systematic Screening of Autosomal Dominant Tubulointerstitial Kidney Disease–MUC1 27dupC Pathogenic Variant through Exome Sequencing
Systematic Screening of Autosomal Dominant Tubulointerstitial Kidney Disease–MUC1 27dupC Pathogenic Variant through Exome Sequencing
Key Points
MUC1 is associated with autosomal dominant tubulointerstitial kidney disease, a ...
Autonomy on Trial
Autonomy on Trial
Photo by CHUTTERSNAP on Unsplash
Abstract
This paper critically examines how US bioethics and health law conceptualize patient autonomy, contrasting the rights-based, individualist...
Diagnostic value of shear wave velocity in polycystic ovarian syndrome
Diagnostic value of shear wave velocity in polycystic ovarian syndrome
Aim: In polycystic ovarian syndrome, the ovaries become stiffer due to chronic
anovulation. We aimed to compare tissue elasticity in terms of shear wave velocities
...
#1148 Polycystic kidney disease—beyond PKD1 and PKD2
#1148 Polycystic kidney disease—beyond PKD1 and PKD2
Abstract
Background and Aims
Autosomal dominant polycystic kidney disease (ADPKD) is a common form of hereditary kidney disease,...
Complex Collision Tumors: A Systematic Review
Complex Collision Tumors: A Systematic Review
Abstract
Introduction: A collision tumor consists of two distinct neoplastic components located within the same organ, separated by stromal tissue, without histological intermixing...
Renal Ewing Sarcoma: A Case Report and Literature Review
Renal Ewing Sarcoma: A Case Report and Literature Review
Abstract
Introduction
Primary renal Ewing sarcoma is an extremely rare and aggressive tumor, representing less than 1% of all renal tumors. This case report contributes valuable in...
Applying Logistic Regression to Predict Diabetic Nephropathy Based on Some Clinical and Paraclinical Characteristics of Type 2 Diabetic Patients
Applying Logistic Regression to Predict Diabetic Nephropathy Based on Some Clinical and Paraclinical Characteristics of Type 2 Diabetic Patients
Today, the incidence of type 2 diabetes mellitus is increasing rapidly on global. This disease is shown with many complications that significantly affect public health. One of them...
The discriminative role of angiopoietin-like protein-3 for metabolic syndrome in polycystic ovary syndrome
The discriminative role of angiopoietin-like protein-3 for metabolic syndrome in polycystic ovary syndrome
SUMMARY OBJECTIVE: Patients with polycystic ovary syndrome face an increased risk of developing metabolic syndrome. Identifying biomarkers that can detect metabolic syndrome in po...

