A Severe Leaf Curl Disease on Chilies in Pakistan is Associated with Multiple Begomovirus Components

Chili leaf curl disease is an important limiting factor for chilies in the Indian subcontinent and is associated with begomoviruses (2,3). Field visits of commercially grown chilies in 2007 and 2008 identified a very severe leaf curl disease with 100% incidence and severe yield losses at several locations in Faisalabad District, Punjab, Pakistan. Symptoms of the disease were severe leaf curl with cup-shaped, upward curling, yellowing, and stunted plant growth. To identify the causative agent, symptomatic plant samples were collected from 10 locations and total DNA was extracted with a cetyltrimethylammoniumbromide method. Universal primers that amplify begomovirus DNA A, Begomo F (ACGCGT GCCGTGCTGCTGCCCCCATTGTCC) and Begomo R (ACGCGT ATGGGCTGYCGAAGTTSAGAC), were used in PCR. A PCR product of the expected size (approximately 2.8 kb) was amplified from all symptomatic plants, and no amplification products of the expected size were obtained from healthy or asymptomatic plants, confirming the association of a begomovirus with the disease. When used as a probe in Southern hybridization, a full-length clone of Cotton leaf curl Multan virus detected characteristic viral DNA forms and further confirmed the association of begomovirus with the disease. To identify the begomovirus associated with the disease at the species level, the PCR product obtained with universal primers was cloned into a TA cloning vector and five clones were partially sequenced. Comparison of the DNA sequence of the coat protein gene of clones resulted in identification of two begomovirus species; the first clone (GenBank Accession No. FN179278) showed 94% DNA sequence identity with the bipartite virus Tomato leaf curl New Delhi virus (ToLCNDV), while the second clone (GenBank Accession No. FN252382) showed 97% sequence identity with the monopartite begomovirus Chili leaf curl Multan virus (ChLCMV). Rolling circle amplification was used to clone the DNA B of ToLCNDV from samples showing typical chili leaf curl disease symptoms. Sequence analysis of the DNA B clone (GenBank Accession No. FN179276) in the intergenic region and movement protein gene showed 94% identity with ToLCNDV DNA B. To confirm association of betasatellite with the disease, universal primers (β-01 and β-02) were used for the amplification of betasatellite by PCR (1). DNA sequence analysis of betasatellite (GenBank Accession No. FN179279) associated with the disease showed 90% identity with the previously cloned chili leaf curl betasatellite (1). No evidence for the association of alphasatellite with the disease was found. The multiple infection of a begomovirus complex, consisting of a monopartite virus with a bipartite begomovirus where DNA B is maintained in the presence of betasatellite, presents yet another example of rapid changes in begomovirus complexes that infect important crops in the region. The appearance of chili leaf curl disease at a higher incidence and symptom severity may be attributed to the synergistic action of geminivirus disease complex comprising a monopartite and a bipartite begomovirus along with DNA betasatellite. High yield losses resulting from this severe disease threatens chili cultivation in the area and is forcing farmers to grow other crops. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) B. Chattopadhyay et al. Arch Virol. 10:7, 2007. (3) M. Hussain et al. Plant Pathol. 53:794, 2004.