Javascript must be enabled to continue!
Genetic Analysis of Methylenetetrahydrofolate Reductase (MTHFR) Gene of Polymorphism (rs1801133) in Patients with Non-Syndromic Cleft lip and Palate in the South Indian Population. A Preliminary Case Control Study
View through CrossRef
To identify if an association exists between MTHFR gene polymorphism (rs1801133) and non-syndromic cleft lip (NSCLP) and palate in patients belonging to the South Indian population. 25 patients with NSCLP and 25 healthy patients as controls were enrolled in the study. Genotyping of rs1801133 polymorphism was performed with PCR and amplification refractory mutation system. The primers used were MTHFR-Forward: 5’- TGCTGTTGGAAGGTGCAAGAT - 3’, MTHFRR1: 5’ - GCGTGATGATGAAATCGG - 3’ and MTHFRR2: 5’ - GCGTGATGATGAAATCGA - 3’. Cycling was carried out with an annealing temperature of 58 degree C for 30 seconds Genotype and allele frequency distributions in both the groups were compared using Chi-square test. The frequency of the GA was 100% without GG and AA genotype in group 1 (case group). The allele frequency in group 2 (control group) was found to be GG=24% and GA=76%. The GG homozygous genotype was absent in the case group, whereas the AA homozygous genotype was absent in boths groups. There was a statistically significant deviation from Hardy Weinberg Equilibrium with a p value of <0. 00001 and <0.0022 in the case group control group respectively. Both the groups showed a deviation in Hardy- Weinberg equilibrium depicting an evolving genotyping variant in the South Indian population. Classification of the genotypes based on genetic models such as dominant, recessive or additive did not present any significant association of the polymorphism marker with disease status.
Title: Genetic Analysis of Methylenetetrahydrofolate Reductase (MTHFR) Gene of Polymorphism (rs1801133) in Patients with Non-Syndromic Cleft lip and Palate in the South Indian Population. A Preliminary Case Control Study
Description:
To identify if an association exists between MTHFR gene polymorphism (rs1801133) and non-syndromic cleft lip (NSCLP) and palate in patients belonging to the South Indian population.
25 patients with NSCLP and 25 healthy patients as controls were enrolled in the study.
Genotyping of rs1801133 polymorphism was performed with PCR and amplification refractory mutation system.
The primers used were MTHFR-Forward: 5’- TGCTGTTGGAAGGTGCAAGAT - 3’, MTHFRR1: 5’ - GCGTGATGATGAAATCGG - 3’ and MTHFRR2: 5’ - GCGTGATGATGAAATCGA - 3’.
Cycling was carried out with an annealing temperature of 58 degree C for 30 seconds Genotype and allele frequency distributions in both the groups were compared using Chi-square test.
The frequency of the GA was 100% without GG and AA genotype in group 1 (case group).
The allele frequency in group 2 (control group) was found to be GG=24% and GA=76%.
The GG homozygous genotype was absent in the case group, whereas the AA homozygous genotype was absent in boths groups.
There was a statistically significant deviation from Hardy Weinberg Equilibrium with a p value of <0.
00001 and <0.
0022 in the case group control group respectively.
Both the groups showed a deviation in Hardy- Weinberg equilibrium depicting an evolving genotyping variant in the South Indian population.
Classification of the genotypes based on genetic models such as dominant, recessive or additive did not present any significant association of the polymorphism marker with disease status.
Related Results
Treatment outcomes following alveolar cleft rehabilitation
Treatment outcomes following alveolar cleft rehabilitation
<p dir="ltr">Introduction: Alveolar cleft closure is typically done with bone grafting, and bone healing is assessed radiologically and clinically. However, there is no conse...
Treatment outcomes following alveolar cleft rehabilitation
Treatment outcomes following alveolar cleft rehabilitation
<p dir="ltr">Introduction: Alveolar cleft closure is typically done with bone grafting, and bone healing is assessed radiologically and clinically. However, there is no conse...
Study of the Association between MTHFR Polymorphism (rs1801133) and the Outcome of Methotrexate Treatment in Rheumatoid Arthritis Patient
Study of the Association between MTHFR Polymorphism (rs1801133) and the Outcome of Methotrexate Treatment in Rheumatoid Arthritis Patient
Abstract
Background
Rheumatoid arthritis is a chronic systemic autoimmune disease that causes loss of joint function and signifi...
Incidence of Bilateral Cleft Lip And Palate In A University Hospital Setting-A Retrospective Study
Incidence of Bilateral Cleft Lip And Palate In A University Hospital Setting-A Retrospective Study
Cleft lip and palate (CLP) is one of the most prevalent malformations occurring in the head and neck region. Cleft lip and palate is the second most birth defect in the US after cl...
Current Pattern of Cleft Lip and Palate Deformities in Lagos, Nigeria
Current Pattern of Cleft Lip and Palate Deformities in Lagos, Nigeria
Objective To evaluate the current pattern of cleft lip and/or palate deformities in Lagos, Nigeria. Design Descriptive epidemiology. Setting Statewide survey of patients. Participa...
A revised classification of the cleft lip and palate
A revised classification of the cleft lip and palate
Background
Submucous cleft palate is characterized by muscular diastasis of the velum in the presence of intact mucosa with variable combinations of bifid uvula...
The Evaluation of Hospital Social Responsibility Services in Gatot Soebroto Indonesia Central Army Hospital in 2015 – 2019 of Cleft Lip and Palate Patients
The Evaluation of Hospital Social Responsibility Services in Gatot Soebroto Indonesia Central Army Hospital in 2015 – 2019 of Cleft Lip and Palate Patients
Background : Cleft lip and cleft palate are the most common congenital craniofacial anomalies treated by plastic surgeons. The incidence of cleft lip and palate is higher at lower ...
The role of different factors in the development of cleft lip, palate, or both
The role of different factors in the development of cleft lip, palate, or both
Background: Cleft lip and cleft palate refer to congenital malformations characterized by fissures or divisions in the upper lip, the palatal region of the mouth, or both. Cleft li...

