Search engine for discovering works of Art, research articles, and books related to Art and Culture
ShareThis
Javascript must be enabled to continue!

RESEARCH ON THE DETECTION OF HELICOBACTER PYLORI IN SALIVA OF GASTRITIS AND DUODENITIS PATIENTS BY REAL-TIME PCR TECHNIQUE

View through CrossRef
Background: Helicobacter pylori plays an important role in the etiology and pathogenesis of gastritis and duodenitis. There are two groups of test methods to detect Helicobacter pylori infection: invasive methods and non-invasive methods. Testing for Helicobacter pylori in saliva by real-time PCR technique belongs to group of non-invasive test methods. Objectives: To determine the detection rate of Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients and to investigate some factors related to Helicobacter pylori infection detected in saliva using real-time PCR technique in gastritis and duodenitis. Materials and method: A cross-sectional descriptive study on 91 patients after convenient sampling was preliminarily diagnosed with gastritis and duodenitis with indications for endoscopy and biopsy. Biopsy specimens were used for urease and histopathology tests. Saliva is taken directly from the mouth after spitting into a dedicated bottle and conducting a real-time PCR test. Gene amplification will be performed with a PYLORI-PCR mix containing primers and for the expected target product of 203 base pairs length: 5' - AGCGCTCTCACTTCCATAGGC - 3' and 5' - TCTTCGGTTAAAAAAGCGAT - 3'. Install the program "Protocol" for the Real-time PCR machine to operate with the following cycles: 1 cycle: 950C for 5 minutes; 40 cycles: 950C for 15 seconds, 550C for 1 minute and 720C for 20 seconds. Results: The positive rate for Helicobacter pylori in saliva by realtime PCR technique, urease test and histopathology were 20.9%, 19.8% and 46.2% respectively. The detection rate of H. pylori by real-time PCR in saliva and the detection rate on urease test as well as histopathology had a statistically significant correlation. A few important factors related to Helicobacter pylori-positive patients in saliva as follows: personal history suffer from gastritis and duodenitis 40.7%, reflux esophagitis 67%, and congestive inflammation 75.8%. Conclusions: The rate of detecting Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients in Can Tho University of Medicine and Pharmacy Hospital is higher than urease test and lower than histopathology.
Title: RESEARCH ON THE DETECTION OF HELICOBACTER PYLORI IN SALIVA OF GASTRITIS AND DUODENITIS PATIENTS BY REAL-TIME PCR TECHNIQUE
Description:
Background: Helicobacter pylori plays an important role in the etiology and pathogenesis of gastritis and duodenitis.
There are two groups of test methods to detect Helicobacter pylori infection: invasive methods and non-invasive methods.
Testing for Helicobacter pylori in saliva by real-time PCR technique belongs to group of non-invasive test methods.
Objectives: To determine the detection rate of Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients and to investigate some factors related to Helicobacter pylori infection detected in saliva using real-time PCR technique in gastritis and duodenitis.
Materials and method: A cross-sectional descriptive study on 91 patients after convenient sampling was preliminarily diagnosed with gastritis and duodenitis with indications for endoscopy and biopsy.
Biopsy specimens were used for urease and histopathology tests.
Saliva is taken directly from the mouth after spitting into a dedicated bottle and conducting a real-time PCR test.
Gene amplification will be performed with a PYLORI-PCR mix containing primers and for the expected target product of 203 base pairs length: 5' - AGCGCTCTCACTTCCATAGGC - 3' and 5' - TCTTCGGTTAAAAAAGCGAT - 3'.
Install the program "Protocol" for the Real-time PCR machine to operate with the following cycles: 1 cycle: 950C for 5 minutes; 40 cycles: 950C for 15 seconds, 550C for 1 minute and 720C for 20 seconds.
Results: The positive rate for Helicobacter pylori in saliva by realtime PCR technique, urease test and histopathology were 20.
9%, 19.
8% and 46.
2% respectively.
The detection rate of H.
pylori by real-time PCR in saliva and the detection rate on urease test as well as histopathology had a statistically significant correlation.
A few important factors related to Helicobacter pylori-positive patients in saliva as follows: personal history suffer from gastritis and duodenitis 40.
7%, reflux esophagitis 67%, and congestive inflammation 75.
8%.
Conclusions: The rate of detecting Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients in Can Tho University of Medicine and Pharmacy Hospital is higher than urease test and lower than histopathology.

Related Results

The role of helicobacter pylori in coronary heart disease : laboratory, observational, and interventional studies
The role of helicobacter pylori in coronary heart disease : laboratory, observational, and interventional studies
<p dir="ltr"><b>Background</b></p><p dir="ltr">Helicobacter pylori (H. pylori) infects nearly half of the world's population and causes gastritis, pep...
The role of helicobacter pylori in coronary heart disease : laboratory, observational, and interventional studies
The role of helicobacter pylori in coronary heart disease : laboratory, observational, and interventional studies
<p dir="ltr"><b>Background</b></p><p dir="ltr">Helicobacter pylori (H. pylori) infects nearly half of the world's population and causes gastritis, pep...
Differential E-cadherin expression in helicobacter-related gastric pathology
Differential E-cadherin expression in helicobacter-related gastric pathology
Background and aims E-cadherin plays an important role in the maintenance of cell–cell adhesion. Loss of E-cadherin expression is fundamental in the development of many...
Nodular gastritis in association with gastric cancer development before and after Helicobacter pylori eradication
Nodular gastritis in association with gastric cancer development before and after Helicobacter pylori eradication
Background and AimNodular gastritis is caused by Helicobacter pylori infection and is associated with the development of diffuse‐type gastric cancer. This study examined the clinic...
Stres psikologis dengan kejadian gastritis pada narapidana di sukadana, Lampung
Stres psikologis dengan kejadian gastritis pada narapidana di sukadana, Lampung
Psychological stress in gastritis occurrence among prisoners at sukadana, LampungBackground: Based on Indonesia's health profile in 2011, gastritis is one of the 10 most common dis...
pdf Exploring the Link Between Helicobacter Pylori Infection Severity and Metabolic Disruptions: The Role of IL-17F as a Key Biomarker
pdf Exploring the Link Between Helicobacter Pylori Infection Severity and Metabolic Disruptions: The Role of IL-17F as a Key Biomarker
Helicobacter pylori is a Gram-negative, microaerophilic bacterium that colonises. Aims to evaluate the relationship between H. pylori infection severity and metabolic disorder. A c...

Back to Top