Javascript must be enabled to continue!
RESEARCH ON THE DETECTION OF HELICOBACTER PYLORI IN SALIVA OF GASTRITIS AND DUODENITIS PATIENTS BY REAL-TIME PCR TECHNIQUE
View through CrossRef
Background: Helicobacter pylori plays an important role in the etiology and pathogenesis of gastritis and duodenitis. There are two groups of test methods to detect Helicobacter pylori infection: invasive methods and non-invasive methods. Testing for Helicobacter pylori in saliva by real-time PCR technique belongs to group of non-invasive test methods. Objectives: To determine the detection rate of Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients and to investigate some factors related to Helicobacter pylori infection detected in saliva using real-time PCR technique in gastritis and duodenitis. Materials and method: A cross-sectional descriptive study on 91 patients after convenient sampling was preliminarily diagnosed with gastritis and duodenitis with indications for endoscopy and biopsy. Biopsy specimens were used for urease and histopathology tests. Saliva is taken directly from the mouth after spitting into a dedicated bottle and conducting a real-time PCR test. Gene amplification will be performed with a PYLORI-PCR mix containing primers and for the expected target product of 203 base pairs length: 5' - AGCGCTCTCACTTCCATAGGC - 3' and 5' - TCTTCGGTTAAAAAAGCGAT - 3'. Install the program "Protocol" for the Real-time PCR machine to operate with the following cycles: 1 cycle: 950C for 5 minutes; 40 cycles: 950C for 15 seconds, 550C for 1 minute and 720C for 20 seconds. Results: The positive rate for Helicobacter pylori in saliva by realtime PCR technique, urease test and histopathology were 20.9%, 19.8% and 46.2% respectively. The detection rate of H. pylori by real-time PCR in saliva and the detection rate on urease test as well as histopathology had a statistically significant correlation. A few important factors related to Helicobacter pylori-positive patients in saliva as follows: personal history suffer from gastritis and duodenitis 40.7%, reflux esophagitis 67%, and congestive inflammation 75.8%. Conclusions: The rate of detecting Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients in Can Tho University of Medicine and Pharmacy Hospital is higher than urease test and lower than histopathology.
Can Tho University of Medicine and Pharmacy
Title: RESEARCH ON THE DETECTION OF HELICOBACTER PYLORI IN SALIVA OF GASTRITIS AND DUODENITIS PATIENTS BY REAL-TIME PCR TECHNIQUE
Description:
Background: Helicobacter pylori plays an important role in the etiology and pathogenesis of gastritis and duodenitis.
There are two groups of test methods to detect Helicobacter pylori infection: invasive methods and non-invasive methods.
Testing for Helicobacter pylori in saliva by real-time PCR technique belongs to group of non-invasive test methods.
Objectives: To determine the detection rate of Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients and to investigate some factors related to Helicobacter pylori infection detected in saliva using real-time PCR technique in gastritis and duodenitis.
Materials and method: A cross-sectional descriptive study on 91 patients after convenient sampling was preliminarily diagnosed with gastritis and duodenitis with indications for endoscopy and biopsy.
Biopsy specimens were used for urease and histopathology tests.
Saliva is taken directly from the mouth after spitting into a dedicated bottle and conducting a real-time PCR test.
Gene amplification will be performed with a PYLORI-PCR mix containing primers and for the expected target product of 203 base pairs length: 5' - AGCGCTCTCACTTCCATAGGC - 3' and 5' - TCTTCGGTTAAAAAAGCGAT - 3'.
Install the program "Protocol" for the Real-time PCR machine to operate with the following cycles: 1 cycle: 950C for 5 minutes; 40 cycles: 950C for 15 seconds, 550C for 1 minute and 720C for 20 seconds.
Results: The positive rate for Helicobacter pylori in saliva by realtime PCR technique, urease test and histopathology were 20.
9%, 19.
8% and 46.
2% respectively.
The detection rate of H.
pylori by real-time PCR in saliva and the detection rate on urease test as well as histopathology had a statistically significant correlation.
A few important factors related to Helicobacter pylori-positive patients in saliva as follows: personal history suffer from gastritis and duodenitis 40.
7%, reflux esophagitis 67%, and congestive inflammation 75.
8%.
Conclusions: The rate of detecting Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients in Can Tho University of Medicine and Pharmacy Hospital is higher than urease test and lower than histopathology.
Related Results
Differential E-cadherin expression in helicobacter-related gastric pathology
Differential E-cadherin expression in helicobacter-related gastric pathology
Background and aims
E-cadherin plays an important role in the maintenance of cell–cell adhesion. Loss of E-cadherin expression is fundamental in the development of many...
Stres psikologis dengan kejadian gastritis pada narapidana di sukadana, Lampung
Stres psikologis dengan kejadian gastritis pada narapidana di sukadana, Lampung
Psychological stress in gastritis occurrence among prisoners at sukadana, LampungBackground: Based on Indonesia's health profile in 2011, gastritis is one of the 10 most common dis...
Helicobacter pylori Isolate from Endoscopy Examined Patients in Bahir Dar, North West Ethiopia Helicobacter pylori Isolate from Endoscopy Examined Patients in Bahir Dar, North West Ethiopia
Helicobacter pylori Isolate from Endoscopy Examined Patients in Bahir Dar, North West Ethiopia Helicobacter pylori Isolate from Endoscopy Examined Patients in Bahir Dar, North West Ethiopia
Background: The Helicobacter pylori infection is highly prevalent throughout the world and causes gastric-associated diseases. Its microbial niche is the stomach, where it causes d...
Interferon gamma and interleukin 4 secreting cells in the gastric antrum in Helicobacter pylori positive and negative gastritis.
Interferon gamma and interleukin 4 secreting cells in the gastric antrum in Helicobacter pylori positive and negative gastritis.
Little is known of the function of the T cells in the inflammatory infiltrate in Helicobacter pylori associated gastritis. This study thus measured T cell in vivo activation by enu...
Helicobacter pylori infection and related factors among pregnant women at Debre Tabor General Hospital, Northwest Ethiopia, 2021
Helicobacter pylori infection and related factors among pregnant women at Debre Tabor General Hospital, Northwest Ethiopia, 2021
Abstract
Introduction: Infection with Helicobacter pylori is one of the most frequent chronic bacterial illnesses in humans, infecting more than half of the world's populat...
PCR based identification of Helicobacter pylori infection in saliva samples
PCR based identification of Helicobacter pylori infection in saliva samples
Helicobacter pylori (H. pylori) are recognized as fastidious chronic bacterial infections in humans, commonly leads to gastritis, peptic ulcer, gastric cancers and gastric malt lym...
Relationship Between Knowledge of Acute Gastritis and Prevention Behavior of Acute Gastritis STIKes Panti Waluya Malang
Relationship Between Knowledge of Acute Gastritis and Prevention Behavior of Acute Gastritis STIKes Panti Waluya Malang
Background: Acute gastritis is an inflammation that occurs on the mucosal surface of the stomach due to an unhealthy lifestyle. Gastritis is often suffered by students.Prevent acut...
Clinicopathological Characteristics and Endoscopic Features of Early Gastric Cancers Diagnosed After Helicobacter pylori Eradication
Clinicopathological Characteristics and Endoscopic Features of Early Gastric Cancers Diagnosed After Helicobacter pylori Eradication
Abstract
Background. Helicobacter pylori (H. pylori) infection is an important risk factor for developing gastric cancer. However, even after H. pylori eradication, early g...

