Detecting and differentiating Acremonium implicatum : developing a PCR‐based method for an endophytic fungus associated with the genus Brachiaria

SUMMARY Brachiaria is a pan‐tropical genus of grasses with about 100 species. The fungus Acremonium implicatum can develop an endophytic association that is mutually beneficial with Brachiaria species. We developed a polymerase chain reaction (PCR)‐based method by first amplifying DNA from A. implicatum isolates using the Random amplified polymorphic DNA (RAPD) technique with arbitrary 10‐mer primers. A 500‐bp PCR product, amplified with primer OPAK‐10 and common to A. implicatum isolates, was selected for further evaluation. The fragment was digoxygenin‐labelled and used to probe a dot blot containing genomic DNA from isolates of A. implicatum and non‐endophytic fungi, and from Brachiaria species free of endophytes. Strong signals were obtained only for DNA from A. implicatum isolates. This fragment was cloned and subsequently sequenced. Based on the sequence data, two primers were selected and synthesized: P1 (5′‐TTCGAATGATAAGGCAGATC‐3′) and P4 (5′‐ACGCATCCACTGTATGCTAC‐3′). The primer pair amplified a single fragment of about 500 bp from DNA of A. implicatum isolates, whether from pure culture or in association with Brachiaria plants. No amplification product was detected in DNA from endophyte‐free plants, pathogenic fungi, the bacterium Xanthomonas campestris pv. graminis , or non‐pathogenic fungi associated with Brachiaria . This assay thus allows the precise and rapid detection of endophytes in Brachiaria plants and permits a differentiation between endophytic and non‐endophytic fungi.