Search engine for discovering works of Art, research articles, and books related to Art and Culture
ShareThis
Javascript must be enabled to continue!

First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio

View through CrossRef
Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.
Title: First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio
Description:
Boxwood (Buxus sempervirens L.
and other species) is a popular evergreen shrub used in landscaping.
In January 2012, three nursery-grown plants of cv.
Green Gem boxwood were submitted from Warren County, Ohio to the C.
Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory.
The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present.
Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots.
A root scraping showed nematodes present in the lesions.
Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3).
A high number of lesion nematodes (Pratylenchus sp.
) were observed from both soil and root samples.
Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2).
Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli.
The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones.
The esophagus overlapped the intestine ventrally.
Female (n = 12) body length ranged from 410.
3 to 654.
5 μm (mean 583.
0 μm), stylet length from 15.
0 to 17.
8 μm (mean 16.
8 μm), tail length from 23.
2 to 37.
5 μm (mean 29.
2 μm), vulva position from 78.
9 to 85.
6% (mean 81.
7%), dorsal esophageal outlet (DGO) from 2.
6 to 3.
5 μm (mean 3.
1 μm), and with functional oblong spermathecae.
De Man ratios were as follows: a = 25.
3 to 33.
3 (mean 28.
4), b = 4.
1 to 7.
6 (mean 6.
0), c = 16.
1 to 23.
5 (mean 20.
1), and c′ = 1.
8 to 2.
6 (mean 2.
1).
Male (n = 16) body length ranged from 478.
0 to 589.
0 μm (mean 537.
9 μm), stylet length from 15.
0 to 17.
2 μm (mean 16.
2 μm), tail length from 22.
7 to 28.
1 μm (mean 25.
5 μm), spicule from 15.
0 to 17.
5 μm (mean 16.
4 μm), gubernaculum from 3.
5 to 4.
7 μm (mean 4.
0 μm), and DGO from 2.
6 to 3.
7 μm (mean 3.
1 μm).
De Man ratios were as follows: a = 26.
4 to 36.
3 (mean 30.
5), b = 5.
0 to 7.
9 (mean 5.
8), c = 19.
1 to 23.
0 (mean 21.
1), and c′ = 1.
6 to 2.
4 (mean 2.
0).
DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4).
The PCR product was purified and sequenced.
The sequence was deposited in GenBank (Accession No.
JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search.
The comparison revealed a sequence similarity of 98 to 99% with P.
vulnus (e.
g.
, GenBank Accession Nos.
HM469437.
1, EU130886.
1, and JQ003994.
1).
P.
vulnus is a known pathogen of boxwood (1).
To our knowledge, this is the first report of P.
vulnus in Ohio.
References: (1) K.
R.
Barker.
Plant Dis.
Rep.
58:991, 1974.
(2) P.
Castillo and N.
Vovlas.
Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management.
Koninklijke Brill NV, Leiden, the Netherlands, 2007.
(3) D.
J.
Hooper.
In: Laboratory Methods for Work with Plant and Soil Nematodes.
J.
F.
Southey, ed.
Reference book 402.
Ministry of Agriculture, Fisheries and Food, London, 1986.
(4) G.
C.
Tenente et al.
Nematropica 34:1, 2004.

Related Results

Hydatid Disease of The Brain Parenchyma: A Systematic Review
Hydatid Disease of The Brain Parenchyma: A Systematic Review
Abstarct Introduction Isolated brain hydatid disease (BHD) is an extremely rare form of echinococcosis. A prompt and timely diagnosis is a crucial step in disease management. This ...
Breast Carcinoma within Fibroadenoma: A Systematic Review
Breast Carcinoma within Fibroadenoma: A Systematic Review
Abstract Introduction Fibroadenoma is the most common benign breast lesion; however, it carries a potential risk of malignant transformation. This systematic review provides an ove...
Overview of Plant-Nematode Interactions and Understanding Plant Defense Mechanisms
Overview of Plant-Nematode Interactions and Understanding Plant Defense Mechanisms
Plant-nematode interactions represent a dynamic interplay between parasitic nematodes and their host plants, influencing plant health and agricultural productivity worldwide. This ...
Gastric Pyloric Schwannoma: A Case Report and Review of the Literature
Gastric Pyloric Schwannoma: A Case Report and Review of the Literature
Abstract Introduction Schwannomas are slow-growing, subclinical neoplasms rarely found in the gastrointestinal tract. This study reports a schwannoma in the pyloric region of the s...
Deep Potential of Ohio
Deep Potential of Ohio
This paper was prepared for the Eastern Regional Meeting of the Society of Petroleum Engineers of AIME, to be held in Columbus, Ohio, Nov. 8–9, 1972. Permission to copy is restrict...
Strong homogenization effects of shrubs on nematode communities across large spatial scales on the Qinghai-Tibet Plateau
Strong homogenization effects of shrubs on nematode communities across large spatial scales on the Qinghai-Tibet Plateau
Climate change and shrub encroachment affect nematode biodiversity, although shrub species had different effects on below-ground community. Yet, the consequences of shrub species o...
Detection of Pine Wilt Nematode from Drone Images Using UAV
Detection of Pine Wilt Nematode from Drone Images Using UAV
Pine wilt nematode disease is a devastating forest disease that spreads rapidly. Using drone remote sensing to monitor pine wilt nematode trees promptly is an effective way to cont...

Back to Top