Search engine for discovering works of Art, research articles, and books related to Art and Culture
Javascript must be enabled to continue!
pL0R-LacZ v1
View through CrossRef
Name: pL0R-LacZ Description: a L0 receiver vector which can be used for domestication using SapI-mediated restriction ligation or Gibson assembly. Contains lacZ for blue/white colony screening. Requires X-GAL, IPTG optional depending on E. coli strain. Level 0 Overhangs: Special (cuts into BsaI sites) Length: 2646 Antibiotic selection: Spectynomycin Other info: pMB1 ori Characterisation: ++++ (substantial), works as expected. Primers: U1FCATTACTCGCATCCATTCTCU1RGAGACGAGACGAGACAGCCTUXFCCAGGATACATAGATTACCAUXRGGTGGAAGGGCTCGGAGTTGL0FTGGGCTGCCTGTATCGAGTGL0RGCTGGCCTTTTGCTCACA L0 F works great for sequencing. Submitter: Bernardo Pollak Cloned by: Bernardo Pollak Availability: Upon request at the Pollak/Dupont/Federici labs at the moment and will be available soon from Addgene.
Title: pL0R-LacZ v1
Description:
Name: pL0R-LacZ Description: a L0 receiver vector which can be used for domestication using SapI-mediated restriction ligation or Gibson assembly.
Contains lacZ for blue/white colony screening.
Requires X-GAL, IPTG optional depending on E.
coli strain.
Level 0 Overhangs: Special (cuts into BsaI sites) Length: 2646 Antibiotic selection: Spectynomycin Other info: pMB1 ori Characterisation: ++++ (substantial), works as expected.
Primers: U1FCATTACTCGCATCCATTCTCU1RGAGACGAGACGAGACAGCCTUXFCCAGGATACATAGATTACCAUXRGGTGGAAGGGCTCGGAGTTGL0FTGGGCTGCCTGTATCGAGTGL0RGCTGGCCTTTTGCTCACA L0 F works great for sequencing.
Submitter: Bernardo Pollak Cloned by: Bernardo Pollak Availability: Upon request at the Pollak/Dupont/Federici labs at the moment and will be available soon from Addgene.
Related Results
Neuregulin-1 promotes formation of the murine cardiac conduction system
Neuregulin-1 promotes formation of the murine cardiac conduction system
The cardiac conduction system is a network of cells responsible for the rhythmic and coordinated excitation of the heart. Components of the murine conduction system, including the ...
Visualization of lymphatic vessels through NF-κB activity
Visualization of lymphatic vessels through NF-κB activity
AbstractThe molecular biology of lymphatics is only rudimentary owing to the long-standing absence of specific markers, and scanty is the information regarding bladder lymphatic ve...
Action of Photodynamic Therapy at Low Fluence in 9 L/lacZ Cells after Interaction with Chlorins
Action of Photodynamic Therapy at Low Fluence in 9 L/lacZ Cells after Interaction with Chlorins
Gliosarcoma (GS) is a primary malignant neoplasm of the central nervous system, treated with an unfavorable prognosis with surgery, radiotherapy, and chemotherapy. The treatment fo...
CGRP Receptors
CGRP Receptors
Neuronal Expression and Regulation of CGRP Promoter Activity Following Viral Gene Transfer into Cultured Trigeminal Ganglia NeuronsWe examined the regulation of calcitonin gene‐rel...
Augmentation of rat skin flap viability by relaxin‐expressing adenovirus
Augmentation of rat skin flap viability by relaxin‐expressing adenovirus
AbstractRelaxin (RLX) has multiple vascular actions, including vasodilation and angiogenesis, which occur via induction of vascular endothelial growth factor (VEGF) expression. We ...
Effect of Tangeretin against Ethyl Methanesulfonate Induced Toxicity in the third Instar Larvae of Transgenic Drosophila melanogaster (hsp70-lacZ Bg9)
Effect of Tangeretin against Ethyl Methanesulfonate Induced Toxicity in the third Instar Larvae of Transgenic Drosophila melanogaster (hsp70-lacZ Bg9)
Background:
Tangeretin is a polymethoxylated flavone naturally found in the peels of Citrus reticulata. Ethyl methanesulfonate (EMS) is a well-known alkylating agent recognized for...
Evaluation of the toxic potential of Bisphenol-A glycidylmethacrylate (BisGMA) on the third instar larvae of transgenic Drosophila
Evaluation of the toxic potential of Bisphenol-A glycidylmethacrylate (BisGMA) on the third instar larvae of transgenic Drosophila
Abstract
Introduction
In the present study the cytotoxic and genotoxic effects of Bisphenol-A glycidyl methacrylate (BisGMA) was...
Partial FAM19A5 Deficiency in Mice Leads to Disrupted Spine Maturation, Hyperactivity, and an Altered Fear Response
Partial FAM19A5 Deficiency in Mice Leads to Disrupted Spine Maturation, Hyperactivity, and an Altered Fear Response
ABSTRACTThe FAM19A5polypeptide, encoded by the TAFA5gene, is evolutionarily conserved among vertebral species. This protein is predominantly expressed in the brain, highlighting it...