Search engine for discovering works of Art, research articles, and books related to Art and Culture
ShareThis
Javascript must be enabled to continue!

pL0R-LacZ v1

View through CrossRef
Name: pL0R-LacZ Description: a L0 receiver vector which can be used for domestication using SapI-mediated restriction ligation or Gibson assembly. Contains lacZ for blue/white colony screening. Requires X-GAL, IPTG optional depending on E. coli strain. Level 0 Overhangs: Special (cuts into BsaI sites) Length: 2646 Antibiotic selection: Spectynomycin Other info: pMB1 ori Characterisation: ++++ (substantial), works as expected. Primers: U1FCATTACTCGCATCCATTCTCU1RGAGACGAGACGAGACAGCCTUXFCCAGGATACATAGATTACCAUXRGGTGGAAGGGCTCGGAGTTGL0FTGGGCTGCCTGTATCGAGTGL0RGCTGGCCTTTTGCTCACA L0 F works great for sequencing. Submitter: Bernardo Pollak Cloned by: Bernardo Pollak Availability: Upon request at the Pollak/Dupont/Federici labs at the moment and will be available soon from Addgene.
ZappyLab, Inc.
Title: pL0R-LacZ v1
Description:
Name: pL0R-LacZ Description: a L0 receiver vector which can be used for domestication using SapI-mediated restriction ligation or Gibson assembly.
Contains lacZ for blue/white colony screening.
Requires X-GAL, IPTG optional depending on E.
coli strain.
Level 0 Overhangs: Special (cuts into BsaI sites) Length: 2646 Antibiotic selection: Spectynomycin Other info: pMB1 ori Characterisation: ++++ (substantial), works as expected.
Primers: U1FCATTACTCGCATCCATTCTCU1RGAGACGAGACGAGACAGCCTUXFCCAGGATACATAGATTACCAUXRGGTGGAAGGGCTCGGAGTTGL0FTGGGCTGCCTGTATCGAGTGL0RGCTGGCCTTTTGCTCACA L0 F works great for sequencing.
Submitter: Bernardo Pollak Cloned by: Bernardo Pollak Availability: Upon request at the Pollak/Dupont/Federici labs at the moment and will be available soon from Addgene.

Back to Top