Javascript must be enabled to continue!
First report of tomato spotted wilt virus infecting Panax notoginseng in Wenshan, China
View through CrossRef
Panax notoginseng (Burk.) F.H. Chen in the family Araliaceae is a widely used traditional Chinese medicine for its abilities to improve blood circulation and ameliorate hemostasis (Wang et al. 2016). In July 2024, P. notoginseng plants exhibiting chlorotic spots and yellowing on the leaves were observed in four separate fields of 0.5-1.2 ha, with average 7% disease incidence in the surveyed fields in Wenshan County, Yunnan Province, China. Tospovirus-like particles, measuring from 65 to 100 nm in diameter, were observed by electron microscopy in crude sap prepared from symptomatic leaf tissue excised in 2.5% isoamyl alcohol, followed by negative staining with 2% ammonium molybdate (pH 6.5) (Hu et al., 2023). No virion was observed in the sap of asymptomatic plants. To identify the causal viruses of the disease, leaves of twenty-four symptomatic and three asymptomatic plants were collected from Wenshan, China. Total RNA was then extracted using Eastep® Super Total RNA Extraction Kit (Promega, Shanghai, China). The presence of tomato spotted wilt virus (TSWV) was verified via the method descripted by Huang et al (2018). Two pairs of specific primers, i.e. TZSV-N-F/N-R (5′-ATGTCTAACGTCCGGAGTTTAACA-3′/5′-AAAAGACAGATCATTGCTGCTCTT-3′) and TSWV-N-2300F/2300R (CGGGATCCATGTCTAAGGTTAAGCTCAC/5′-GCTCTAGATTAAGCAAGTTCTGCAAGTTTT-3′), were used to amplify the N genes of tomato zonate spot virus (TZSV) and TSWV by one step RT-PCR, respectively. Twenty-two symptomatic out of 27 samples tested positive for TSWV only, and negative for TZSV. Twenty-two PCR products were sequenced by Sanger sequencing (Sangon, China). Blastn search showed that the obtained 796-nt fragments shared ≥98.00% nt identity with TSWV isolate YKMiSFQ1 (MW404245.1) from Tamarillo. To obtain the complete genome of this TSWV isolate, named TSWV-notoginseng, we conducted overlapping RT-PCR with TSWV-specific primers listed in the supplementary material (Table S1). L, M, and S segments of the TSWV-notoginseng genome were determined to be 8913 nt, 4773 nt and 2972nt, respectively, and the sequences were deposited in GenBank (PV540053, PV540054, and PV540055). The Blastn analysis revealed that three segments (L, M, and S) of the TSWV-notoginseng genome exhibited sequence identities of 99.5%, 99.5%, and 98.0%, respectively, with the L segment of the TSWV-YN5577 strain (isolated from Tropaeolum majus MF422032.1; Yu et al. 2021), the M segment of the TSWV-YNHS strain (isolated from Arachis hypogaea, MN365035.1), and the S segment of the TSWV-Celery strain (isolated from celery,KU356854.1). Three segments of TSWV-notoginseng genome originated from three different isolates of TSWV, indicating TSWV-notoginseng isolate may be a reassortant. To further confirm the possibility that P. notoginseng is a natural host of TSWV, leaf extract of TSWV-notoginseng infected plant was mechanically inoculated on the leaves of one-year-old P. notoginseng plants. Systemically infected leaves of the inoculated plants exhibited chlorotic spots and yellowing symptoms at 14 days post inoculation. TSWV-notoginseng infection was confirmed by RT-PCR using the primer pairs TSWV-N-2300F/2300R, followed by Sanger nucleotide sequencing (Sangon, China). TSWV (family Tospoviridae) can infect more than 1,000 species of plants (Pappu et al. 2009). Our results suggest that TSWV has been expanding the host range through genetic reassortment.
Scientific Societies
Title: First report of tomato spotted wilt virus infecting Panax notoginseng in Wenshan, China
Description:
Panax notoginseng (Burk.
) F.
H.
Chen in the family Araliaceae is a widely used traditional Chinese medicine for its abilities to improve blood circulation and ameliorate hemostasis (Wang et al.
2016).
In July 2024, P.
notoginseng plants exhibiting chlorotic spots and yellowing on the leaves were observed in four separate fields of 0.
5-1.
2 ha, with average 7% disease incidence in the surveyed fields in Wenshan County, Yunnan Province, China.
Tospovirus-like particles, measuring from 65 to 100 nm in diameter, were observed by electron microscopy in crude sap prepared from symptomatic leaf tissue excised in 2.
5% isoamyl alcohol, followed by negative staining with 2% ammonium molybdate (pH 6.
5) (Hu et al.
, 2023).
No virion was observed in the sap of asymptomatic plants.
To identify the causal viruses of the disease, leaves of twenty-four symptomatic and three asymptomatic plants were collected from Wenshan, China.
Total RNA was then extracted using Eastep® Super Total RNA Extraction Kit (Promega, Shanghai, China).
The presence of tomato spotted wilt virus (TSWV) was verified via the method descripted by Huang et al (2018).
Two pairs of specific primers, i.
e.
TZSV-N-F/N-R (5′-ATGTCTAACGTCCGGAGTTTAACA-3′/5′-AAAAGACAGATCATTGCTGCTCTT-3′) and TSWV-N-2300F/2300R (CGGGATCCATGTCTAAGGTTAAGCTCAC/5′-GCTCTAGATTAAGCAAGTTCTGCAAGTTTT-3′), were used to amplify the N genes of tomato zonate spot virus (TZSV) and TSWV by one step RT-PCR, respectively.
Twenty-two symptomatic out of 27 samples tested positive for TSWV only, and negative for TZSV.
Twenty-two PCR products were sequenced by Sanger sequencing (Sangon, China).
Blastn search showed that the obtained 796-nt fragments shared ≥98.
00% nt identity with TSWV isolate YKMiSFQ1 (MW404245.
1) from Tamarillo.
To obtain the complete genome of this TSWV isolate, named TSWV-notoginseng, we conducted overlapping RT-PCR with TSWV-specific primers listed in the supplementary material (Table S1).
L, M, and S segments of the TSWV-notoginseng genome were determined to be 8913 nt, 4773 nt and 2972nt, respectively, and the sequences were deposited in GenBank (PV540053, PV540054, and PV540055).
The Blastn analysis revealed that three segments (L, M, and S) of the TSWV-notoginseng genome exhibited sequence identities of 99.
5%, 99.
5%, and 98.
0%, respectively, with the L segment of the TSWV-YN5577 strain (isolated from Tropaeolum majus MF422032.
1; Yu et al.
2021), the M segment of the TSWV-YNHS strain (isolated from Arachis hypogaea, MN365035.
1), and the S segment of the TSWV-Celery strain (isolated from celery,KU356854.
1).
Three segments of TSWV-notoginseng genome originated from three different isolates of TSWV, indicating TSWV-notoginseng isolate may be a reassortant.
To further confirm the possibility that P.
notoginseng is a natural host of TSWV, leaf extract of TSWV-notoginseng infected plant was mechanically inoculated on the leaves of one-year-old P.
notoginseng plants.
Systemically infected leaves of the inoculated plants exhibited chlorotic spots and yellowing symptoms at 14 days post inoculation.
TSWV-notoginseng infection was confirmed by RT-PCR using the primer pairs TSWV-N-2300F/2300R, followed by Sanger nucleotide sequencing (Sangon, China).
TSWV (family Tospoviridae) can infect more than 1,000 species of plants (Pappu et al.
2009).
Our results suggest that TSWV has been expanding the host range through genetic reassortment.
Related Results
Changes characteristics of soil microbial biomass carbon,nitrogen and enzyme activity of Panax notoginseng under optimal management of water and fertilizer
Changes characteristics of soil microbial biomass carbon,nitrogen and enzyme activity of Panax notoginseng under optimal management of water and fertilizer
There is a lack of understanding of the dynamic characteristics of
carbon, nitrogen, and enzyme activity of soil microbial load of Panax
notoginseng in water-fertilizer intercrops....
Evaluation of Selected Tomato Cultivars Effectiveness Against Tomato Yellow Leaf Curl Virus (TYLCV) and Its PCR-Based Molecular Detection
Evaluation of Selected Tomato Cultivars Effectiveness Against Tomato Yellow Leaf Curl Virus (TYLCV) and Its PCR-Based Molecular Detection
Viral diseases are the primary impediment to tomato cultivation. One of the most destructive viral diseases is Tomato yellow leaf curl virus (TYLCV) transmitted by the insect vecto...
Analysis of Microbial Diversity in Rhizosphere Soil of Panax notoginseng under Different Water and Microbial Fertilizer Conditions
Analysis of Microbial Diversity in Rhizosphere Soil of Panax notoginseng under Different Water and Microbial Fertilizer Conditions
Panax notoginseng is a highly regarded medicinal plant that has obstacles associated with continuous cropping. Understanding soil microorganisms is crucial, as they play a major ro...
TaqMan Probe-Based Quantitative Real-Time PCR to Detect Panax notoginseng in Traditional Chinese Patent Medicines
TaqMan Probe-Based Quantitative Real-Time PCR to Detect Panax notoginseng in Traditional Chinese Patent Medicines
Background: There has been global concern about the safety and accuracy of traditional Chinese patent medicines (TCPMs). Panax notoginseng, also known as sanqi, is an important con...
Interactions Between Phenolic Acids and Microorganisms in Rhizospheric Soil From Continuous Cropping of Panax notoginseng
Interactions Between Phenolic Acids and Microorganisms in Rhizospheric Soil From Continuous Cropping of Panax notoginseng
Large-scale intensive cultivation has made continuous cropping soil sickness more serious for Panax notoginseng in Yunnan. Autotoxic substances can promote the occurrence of contin...
Hydatid Disease of The Brain Parenchyma: A Systematic Review
Hydatid Disease of The Brain Parenchyma: A Systematic Review
Abstarct
Introduction
Isolated brain hydatid disease (BHD) is an extremely rare form of echinococcosis. A prompt and timely diagnosis is a crucial step in disease management. This ...
Optimization of Water and Fertilizer Management of Panax notoginseng Based on Changes in Soil Microbial Biomass Carbon and Nitrogen and Enzyme Activities
Optimization of Water and Fertilizer Management of Panax notoginseng Based on Changes in Soil Microbial Biomass Carbon and Nitrogen and Enzyme Activities
Abstract
At present, there is a lack of understanding of the dynamic characteristics of the carbon, nitrogen, and enzyme activities of the soil microbial biomass of Panax n...
Importance of using tomato serum in the development of functional food products
Importance of using tomato serum in the development of functional food products
Background: The significance of incorporating tomatoes in the development of functional food products is due to their content of vitamins, carotenoids, and minerals. In industrial ...

