Javascript must be enabled to continue!
Frequency and functional relevance of genetic threonine145/methionine145 dimorphism in platelet glycoprotein Ibα in an Italian population
View through CrossRef
Background: Threonine145/methionine145 dimorphism in platelet glycoprotein (GP) Ibα defines the human platelet antigen (HPA)‐2 system that has been implicated in refractoriness to HLA‐matched platelet transfusion and in neonatal immune thrombocytopenic purpura.Study Design and Methods: The occurrence of this amino acid dimorphism was investigated in 379 Italian blood donors by studying their genomic DNA. Two oligonucleotide primers, Ibα‐3 (5′‐GGACGTCTCCTTCAACCGGC‐3′) and Ibα‐4 (5′‐GCTTTGGTGGGGAACTTGAC‐3′), were used in a polymerase chain reaction to generate a 591‐base pair fragment that was digested with the restriction enzyme Acy I. To investigate whether this dimorphism is involved in the binding of von Willebrand factor (vWF) to GPlb, the binding of vWF to the GPlb/IX complex was measured in two Met145/Met145 and two Thr145/Thr145 subjects.Results: The genotypic frequencies are 78.9% for Thr/Thr, 19.8% for Thr/Met), and 1.3% for Met/Met; the allelic frequencies are 88.8% for Thr145 and 11.2% for Met145. Estimates for binding of subunit molecules per platelet at saturation and inhibition constant in mol per L, respectively, follow. In the presence of ristocetin (0.5 mg/mL), they are 11,460 ± 2,040 and 1.26 ± 0.44 × 10−8 for normals and 11,230 ± 2,330 and 1.29 ± 0.48 × 10−8 for patients. In the presence of botrocetin (2.5 μg/mL), they are 64,260 ± 7,760 and 2.99 ± 0.96 × 10−8 for normals and 65,770 ± 11,570 and 2.47 ± 0.22 × 10−8 for patients. Platelet aggregation responses obtained using platelet‐rich plasma from donors with Met145/Met145 or Thr145/Thr145 genotype were within normal limits.Conclusion: Genotypic and phenotypic frequencies in the HPA‐2 system in this population are consistent with those reported among the white population. Furthermore, the HPA‐2 system is not involved in the binding of vWF to GPlb.
Title: Frequency and functional relevance of genetic threonine145/methionine145 dimorphism in platelet glycoprotein Ibα in an Italian population
Description:
Background: Threonine145/methionine145 dimorphism in platelet glycoprotein (GP) Ibα defines the human platelet antigen (HPA)‐2 system that has been implicated in refractoriness to HLA‐matched platelet transfusion and in neonatal immune thrombocytopenic purpura.
Study Design and Methods: The occurrence of this amino acid dimorphism was investigated in 379 Italian blood donors by studying their genomic DNA.
Two oligonucleotide primers, Ibα‐3 (5′‐GGACGTCTCCTTCAACCGGC‐3′) and Ibα‐4 (5′‐GCTTTGGTGGGGAACTTGAC‐3′), were used in a polymerase chain reaction to generate a 591‐base pair fragment that was digested with the restriction enzyme Acy I.
To investigate whether this dimorphism is involved in the binding of von Willebrand factor (vWF) to GPlb, the binding of vWF to the GPlb/IX complex was measured in two Met145/Met145 and two Thr145/Thr145 subjects.
Results: The genotypic frequencies are 78.
9% for Thr/Thr, 19.
8% for Thr/Met), and 1.
3% for Met/Met; the allelic frequencies are 88.
8% for Thr145 and 11.
2% for Met145.
Estimates for binding of subunit molecules per platelet at saturation and inhibition constant in mol per L, respectively, follow.
In the presence of ristocetin (0.
5 mg/mL), they are 11,460 ± 2,040 and 1.
26 ± 0.
44 × 10−8 for normals and 11,230 ± 2,330 and 1.
29 ± 0.
48 × 10−8 for patients.
In the presence of botrocetin (2.
5 μg/mL), they are 64,260 ± 7,760 and 2.
99 ± 0.
96 × 10−8 for normals and 65,770 ± 11,570 and 2.
47 ± 0.
22 × 10−8 for patients.
Platelet aggregation responses obtained using platelet‐rich plasma from donors with Met145/Met145 or Thr145/Thr145 genotype were within normal limits.
Conclusion: Genotypic and phenotypic frequencies in the HPA‐2 system in this population are consistent with those reported among the white population.
Furthermore, the HPA‐2 system is not involved in the binding of vWF to GPlb.
Related Results
Frequency of Common Chromosomal Abnormalities in Patients with Idiopathic Acquired Aplastic Anemia
Frequency of Common Chromosomal Abnormalities in Patients with Idiopathic Acquired Aplastic Anemia
Objective: To determine the frequency of common chromosomal aberrations in local population idiopathic determine the frequency of common chromosomal aberrations in local population...
PATHOPHYSIOLOGY OF THROMBOCYTOPENIA AND RESULTANT CLINICAL INDICATIONS FOR PLATELET TRANSFUSION
PATHOPHYSIOLOGY OF THROMBOCYTOPENIA AND RESULTANT CLINICAL INDICATIONS FOR PLATELET TRANSFUSION
Careful evaluation of platelet survival data in normal individuals and patients with thrombocytopeniasecondary to marrow aplasia has demonstrated that platelets are lost from circu...
Preparation and characterization of armadillo submandibular glycoproteins
Preparation and characterization of armadillo submandibular glycoproteins
The nine-banded armadillo (Dasypus novemcinctus mexicanus Peters) was chosen for this study so that a comparison could be made of the salivary mucus glycoproteins of an ancient mam...
Autoimmune thrombocytopenic purpura
Autoimmune thrombocytopenic purpura
Adult autoimmune throbocytopenic purpura (ATP) is a platelet disorder that develops in certain individuals with a genetic as well as sex (female) predisposition following an enviro...
Autoimmune thrombocytopenic purpura
Autoimmune thrombocytopenic purpura
Abstract
Adult autoimmune throbocytopenic purpura (ATP) is a platelet disorder that develops in certain individuals with a genetic as well as sex (female) predisposi...
Activated Protein C Resistance: Effect of Platelet Activation, Platelet-Derived Microparticles, and Atherogenic Lipoproteins
Activated Protein C Resistance: Effect of Platelet Activation, Platelet-Derived Microparticles, and Atherogenic Lipoproteins
Plasma and platelet factor Va represent different substrates for activated protein C (APC). In this study, we have measured platelet-dependent APC resistance and the effect of aspi...
Activated Protein C Resistance: Effect of Platelet Activation, Platelet-Derived Microparticles, and Atherogenic Lipoproteins
Activated Protein C Resistance: Effect of Platelet Activation, Platelet-Derived Microparticles, and Atherogenic Lipoproteins
AbstractPlasma and platelet factor Va represent different substrates for activated protein C (APC). In this study, we have measured platelet-dependent APC resistance and the effect...
Mechanisms of Static and Shear-Induced Platelet Adhesion: Differences in the Adhesion Supported by MMRN1 Comparisons with Other β3 Integrin Ligands.
Mechanisms of Static and Shear-Induced Platelet Adhesion: Differences in the Adhesion Supported by MMRN1 Comparisons with Other β3 Integrin Ligands.
Abstract
Platelet adhesion and aggregation at the site of vascular injury are key events in hemostasis and thrombosis. These processes are supported by interactions ...

