Frequency and functional relevance of genetic threonine145/methionine145 dimorphism in platelet glycoprotein Ibα in an Italian population

Background: Threonine145/methionine145 dimorphism in platelet glycoprotein (GP) Ibα defines the human platelet antigen (HPA)‐2 system that has been implicated in refractoriness to HLA‐matched platelet transfusion and in neonatal immune thrombocytopenic purpura.Study Design and Methods: The occurrence of this amino acid dimorphism was investigated in 379 Italian blood donors by studying their genomic DNA. Two oligonucleotide primers, Ibα‐3 (5′‐GGACGTCTCCTTCAACCGGC‐3′) and Ibα‐4 (5′‐GCTTTGGTGGGGAACTTGAC‐3′), were used in a polymerase chain reaction to generate a 591‐base pair fragment that was digested with the restriction enzyme Acy I. To investigate whether this dimorphism is involved in the binding of von Willebrand factor (vWF) to GPlb, the binding of vWF to the GPlb/IX complex was measured in two Met145/Met145 and two Thr145/Thr145 subjects.Results: The genotypic frequencies are 78.9% for Thr/Thr, 19.8% for Thr/Met), and 1.3% for Met/Met; the allelic frequencies are 88.8% for Thr145 and 11.2% for Met145. Estimates for binding of subunit molecules per platelet at saturation and inhibition constant in mol per L, respectively, follow. In the presence of ristocetin (0.5 mg/mL), they are 11,460 ± 2,040 and 1.26 ± 0.44 × 10−8 for normals and 11,230 ± 2,330 and 1.29 ± 0.48 × 10−8 for patients. In the presence of botrocetin (2.5 μg/mL), they are 64,260 ± 7,760 and 2.99 ± 0.96 × 10−8 for normals and 65,770 ± 11,570 and 2.47 ± 0.22 × 10−8 for patients. Platelet aggregation responses obtained using platelet‐rich plasma from donors with Met145/Met145 or Thr145/Thr145 genotype were within normal limits.Conclusion: Genotypic and phenotypic frequencies in the HPA‐2 system in this population are consistent with those reported among the white population. Furthermore, the HPA‐2 system is not involved in the binding of vWF to GPlb.