Search engine for discovering works of Art, research articles, and books related to Art and Culture
ShareThis
Javascript must be enabled to continue!

First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan

View through CrossRef
A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.
Title: First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan
Description:
A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan.
A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T.
durum), 11 wild or cultivated wheat relatives (T.
dicoccoides, T.
beoticum, T.
monococcum, and T.
turgidum), and one oat (Avena sativa).
Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV).
Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples.
To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T.
beoticum, T.
turgidum, and T.
dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3).
Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV).
All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T.
dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair.
Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857).
The Azeri isolates were all similar (0 to 1.
7% nucleotide divergence) except for one isolate (JX275855, from T.
turgidum, 2.
4 to 3.
2% divergence).
An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918).
These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand.
Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV.
The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence.
Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products.
This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan.
These viruses are responsible for serious disease losses in cereal crops worldwide (4).
Their full impact on crops in Azerbaijan is yet to be seen.
References: (1) M.
Deb and J.
M.
Anderson.
J.
Virol.
Meth.
148:17, 2008.
(2) K.
M.
Makkouk and A.
Comeau.
Eur.
J.
Plant Pathol.
100:71, 1994.
(3) C.
M.
Malmstrom and R.
Shu.
J.
Virol.
Meth.
120:69, 2004.
(4) W.
A.
Miller and L.
Rasochovà.
Ann.
Rev.
Phytopathol.
35:167, 1997.

Related Results

First Record of Barley yellow striate mosaic virus, Barley stripe mosaic virus, and Wheat dwarf virus Infecting Cereal Crops in Tunisia
First Record of Barley yellow striate mosaic virus, Barley stripe mosaic virus, and Wheat dwarf virus Infecting Cereal Crops in Tunisia
A survey conducted during April 2000 to identify viruses infecting cereal crops in different regions (Beja, Bizerte, Cap-bon, Jendouba, Kairouan, Siliana, and Zaghouan) of Tunisia ...
First Detection of Wheat dwarf virus in Barley in Spain Associated with an Outbreak of Barley Yellow Dwarf
First Detection of Wheat dwarf virus in Barley in Spain Associated with an Outbreak of Barley Yellow Dwarf
Severe dwarfing, yellowing, and crop failure were observed on barley in northeastern Spain during March and April of 2003. Leaves from 106 plants collected from 15 barley fields we...
Hydatid Disease of The Brain Parenchyma: A Systematic Review
Hydatid Disease of The Brain Parenchyma: A Systematic Review
Abstarct Introduction Isolated brain hydatid disease (BHD) is an extremely rare form of echinococcosis. A prompt and timely diagnosis is a crucial step in disease management. This ...
Characterization of exotic barley genotypes for barley yellow dwarf virus in District Peshawar, Khyber Pakhtunkhwa, Pakistan
Characterization of exotic barley genotypes for barley yellow dwarf virus in District Peshawar, Khyber Pakhtunkhwa, Pakistan
Barley yellow dwarf disease (BYDD) is a destructive viral disease of cereals. Globally significant yield losses were recorded in cereal crops; BYDD losses in barley ranged from 25 ...
First Report of Barley yellow dwarf virus-PAS in Wheat and Barley Grown in the Czech Republic
First Report of Barley yellow dwarf virus-PAS in Wheat and Barley Grown in the Czech Republic
Barley yellow dwarf disease, an important, ubiquitous virus disease of cereal crops worldwide, is caused by a group of related single-stranded RNA viruses assigned to luteovirus (B...
Cover Crop Response to Late‐Season Planting and Nitrogen Application
Cover Crop Response to Late‐Season Planting and Nitrogen Application
Cover crops aid in reducing precipitation runoff, soil erosion, and N losses in highly sloped, mountainous regions. Corn (Zea mays L.) producers in states with late spring warmup a...
ICT TECHNIQUES IN HIGHER EDUCATION: AZERBAIJAN EXPERIENCE IN PANDEMIC
ICT TECHNIQUES IN HIGHER EDUCATION: AZERBAIJAN EXPERIENCE IN PANDEMIC
The purpose of the article is to study the use of ICT techniques in Azerbaijan higher education. The objectives of the study are: 1) to substantiate the role of ICT sector in the A...
Reservoirs of plant virus disease: Occurrence of wheat dwarf virus and barley/cereal yellow dwarf viruses in Sweden
Reservoirs of plant virus disease: Occurrence of wheat dwarf virus and barley/cereal yellow dwarf viruses in Sweden
Abstract Non‐crop plants such as grasses and volunteer plants are an inseparable part of the flora of crop fields and can influence virus incidence in crop plants...

Back to Top